Overview
NameMedtr0013s0100.1
Unique NameMedtr0013s0100.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length948
Homology
BLAST of Medtr0013s0100.1 vs. NCBI nr
Match: gi|356575953|ref|XP_003556100.1| (PREDICTED: F-box/LRR-repeat protein At3g48880-like [Glycine max])
BLAST of Medtr0013s0100.1 vs. NCBI nr
Match: gi|356535883|ref|XP_003536472.1| (PREDICTED: F-box/LRR-repeat protein At3g48880-like isoform X1 [Glycine max] >gi|571484399|ref|XP_006589549.1| PREDICTED: F-box/LRR-repeat protein At3g48880-like isoform X2 [Glycine max] >gi|571484401|ref|XP_006589550.1| PREDICTED: F-box/LRR-repeat protein At3g48880-like isoform X3 [Glycine max] >gi|571484404|ref|XP_006589551.1| PREDICTED: F-box/LRR-repeat protein At3g48880-like isoform X4 [Glycine max])
BLAST of Medtr0013s0100.1 vs. NCBI nr
Match: gi|255539483|ref|XP_002510806.1| (conserved hypothetical protein [Ricinus communis] >gi|223549921|gb|EEF51408.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0013s0100.1 vs. NCBI nr
Match: gi|590672634|ref|XP_007038666.1| (RNI-like superfamily protein isoform 3 [Theobroma cacao] >gi|508775911|gb|EOY23167.1| RNI-like superfamily protein isoform 3 [Theobroma cacao])
BLAST of Medtr0013s0100.1 vs. NCBI nr
Match: gi|502119332|ref|XP_004496582.1| (PREDICTED: F-box/LRR-repeat protein At3g48880-like [Cicer arietinum])
BLAST of Medtr0013s0100.1 vs. NCBI nr
Match: gi|225470694|ref|XP_002262912.1| (PREDICTED: F-box/LRR-repeat protein At3g48880 [Vitis vinifera] >gi|147841766|emb|CAN62210.1| hypothetical protein VITISV_008091 [Vitis vinifera])
BLAST of Medtr0013s0100.1 vs. NCBI nr
Match: gi|297741053|emb|CBI31784.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0013s0100.1 vs. NCBI nr
Match: gi|590672626|ref|XP_007038664.1| (RNI-like superfamily protein isoform 1 [Theobroma cacao] >gi|508775909|gb|EOY23165.1| RNI-like superfamily protein isoform 1 [Theobroma cacao])
BLAST of Medtr0013s0100.1 vs. NCBI nr
Match: gi|470144924|ref|XP_004308096.1| (PREDICTED: F-box/LRR-repeat protein At3g48880-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0013s0100.1 vs. NCBI nr
Match: gi|460377202|ref|XP_004234383.1| (PREDICTED: F-box/LRR-repeat protein At3g48880-like isoform 1 [Solanum lycopersicum] >gi|460377204|ref|XP_004234384.1| PREDICTED: F-box/LRR-repeat protein At3g48880-like isoform 2 [Solanum lycopersicum])
The following BLAST results are available for this feature:
BLAST of Medtr0013s0100.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356575953|ref|XP_003556100.1|1.615280e-10756.01PREDICTED: F-box/LRR-repeat protein At3g48880-like... [more]
gi|356535883|ref|XP_003536472.1|3.490070e-10756.36PREDICTED: F-box/LRR-repeat protein At3g48880-like... [more]
gi|255539483|ref|XP_002510806.1|7.286860e-10554.98conserved hypothetical protein [Ricinus communis] ... [more]
gi|590672634|ref|XP_007038666.1|5.915610e-10153.26RNI-like superfamily protein isoform 3 [Theobroma ... [more]
gi|502119332|ref|XP_004496582.1|1.667790e-9952.58PREDICTED: F-box/LRR-repeat protein At3g48880-like... [more]
gi|225470694|ref|XP_002262912.1|2.774110e-9848.76PREDICTED: F-box/LRR-repeat protein At3g48880 [Vit... [more]
gi|297741053|emb|CBI31784.3|3.576930e-9851.68unnamed protein product [Vitis vinifera][more]
gi|590672626|ref|XP_007038664.1|4.417050e-9852.80RNI-like superfamily protein isoform 1 [Theobroma ... [more]
gi|470144924|ref|XP_004308096.1|4.298930e-9748.24PREDICTED: F-box/LRR-repeat protein At3g48880-like... [more]
gi|460377202|ref|XP_004234383.1|1.239260e-9651.55PREDICTED: F-box/LRR-repeat protein At3g48880-like... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableGENE3D3.80.10.10no descriptioncoord: 103..240
score: 5
NoneNo IPR availableSUPERFAMILY52047RNI-likecoord: 89..240
score: 2.3

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0013s0100.1 ID=Medtr0013s0100.1|Name=Medtr0013s0100.1|organism=Medicago truncatula|type=mRNA|length=948bp
ATGGAAGTTGCAAAAAGGGGTACAATGGAAAACAACATGGTGATTTGGAA
TCTTCTTATGAAAAATCATGAAGACGTTTTGATTGAGATTTTCAAGCGCT
TAGATATCTTTGAATCACCTTCATCTGTTCGTCGTTTTTGTGAGACATGG
GGGAGAGCTAGCAGCAACCAATCGTTTTGGCAAACACTTGATTTCTCCAT
GTTGAGATCTGATTTTATCAAGAGCACTGCTCCGCCATATGTTTGGGTCA
ATTCCAACTTCGACAACACTTTATACAATTTGTTGTTTATTTCATTGAAT
CCCAGCCAAGGGAATATCAAGACTTTGATTTTCCATTACTACTTGTATCT
CACCAATGATCAATTCTTGTACACAGCTAAAAGGTGTCCACTTCTAAGAC
GATTAGTCTTCGTATCTTGGAACAGAATCAACAAAGTGGTAATGCGAAAG
GCTATTAAAGGATGGAAAGATCTAGAGTCAATGACAATGCCTACCATAGA
ATATCCAAATTATATTTTTCAAGAAATTTCAAGGAGTTGCAAGAAATTCA
GAGAACTCAAGGTTATGGGACGTTTAAATTTGCAATTTGCTTCATCTCTC
ACAATAAATCTTCCAAACTTAAGAGTATTGAGTATTCGATGTTCAGGGTT
GGTGAAAGAAGCTCTCATCTTAATTTTAGATAGATTACAATATTTAGAAG
TGCTAAATATTTCACATTCTTGTTTTGTGGAGCCTTTTCCAGATAGTGAG
GAAGGATATAGGTTTATCAGTGATGTTGACACTGACATTATTAGCAAGAA
GGCTTCTAAGTTGCGTGAATTTCACACATGCATGAAAGAATCATGCATCA
TGTGTCATCGAACAAGAGTTGATTGTGGGCTTCCTAGGTGGTTTAGGTAT
GAGGAAGGGATTTGGAAACATGATGAAGTTAGCTCTCTTGCACTCTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated