Overview
NameMedtr0013s0060.1
Unique NameMedtr0013s0060.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length330
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0071944 cell periphery
cellular_component GO:0005618 cell wall
cellular_component GO:0005575 cellular_component
cellular_component GO:0030312 external encapsulating structure
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00031.1621154-2136025-936-7733.81.8e-1234.21.9e-08

Homology
BLAST of Medtr0013s0060.1 vs. NCBI nr
Match: gi|388496176|gb|AFK36154.1| (unknown [Lotus japonicus])
BLAST of Medtr0013s0060.1 vs. NCBI nr
Match: gi|502184098|ref|XP_004517283.1| (PREDICTED: cysteine proteinase inhibitor 5-like [Cicer arietinum])
BLAST of Medtr0013s0060.1 vs. NCBI nr
Match: gi|502149667|ref|XP_004507620.1| (PREDICTED: cysteine proteinase inhibitor 5-like [Cicer arietinum])
BLAST of Medtr0013s0060.1 vs. NCBI nr
Match: gi|449527163|ref|XP_004170582.1| (PREDICTED: cysteine proteinase inhibitor 5-like [Cucumis sativus])
BLAST of Medtr0013s0060.1 vs. NCBI nr
Match: gi|388505810|gb|AFK40971.1| (unknown [Lotus japonicus])
BLAST of Medtr0013s0060.1 vs. NCBI nr
Match: gi|595875888|ref|XP_007212196.1| (hypothetical protein PRUPE_ppa012846mg [Prunus persica] >gi|462408061|gb|EMJ13395.1| hypothetical protein PRUPE_ppa012846mg [Prunus persica])
BLAST of Medtr0013s0060.1 vs. NCBI nr
Match: gi|502149642|ref|XP_004507610.1| (PREDICTED: cysteine proteinase inhibitor 5-like [Cicer arietinum] >gi|502181986|ref|XP_004516920.1| PREDICTED: cysteine proteinase inhibitor 5-like [Cicer arietinum])
BLAST of Medtr0013s0060.1 vs. NCBI nr
Match: gi|565435455|ref|XP_006281295.1| (hypothetical protein CARUB_v10027345mg, partial [Capsella rubella] >gi|482549999|gb|EOA14193.1| hypothetical protein CARUB_v10027345mg, partial [Capsella rubella])
BLAST of Medtr0013s0060.1 vs. NCBI nr
Match: gi|297790905|ref|XP_002863337.1| (hypothetical protein ARALYDRAFT_494218 [Arabidopsis lyrata subsp. lyrata] >gi|297309172|gb|EFH39596.1| hypothetical protein ARALYDRAFT_494218 [Arabidopsis lyrata subsp. lyrata])
BLAST of Medtr0013s0060.1 vs. NCBI nr
Match: gi|502181998|ref|XP_004516922.1| (PREDICTED: cysteine proteinase inhibitor 5-like [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0013s0060.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|388496176|gb|AFK36154.1|7.245300e-1442.28unknown [Lotus japonicus][more]
gi|502184098|ref|XP_004517283.1|7.832470e-1457.35PREDICTED: cysteine proteinase inhibitor 5-like [C... [more]
gi|502149667|ref|XP_004507620.1|4.554180e-1343.52PREDICTED: cysteine proteinase inhibitor 5-like [C... [more]
gi|449527163|ref|XP_004170582.1|1.020270e-1242.68PREDICTED: cysteine proteinase inhibitor 5-like [C... [more]
gi|388505810|gb|AFK40971.1|1.688870e-1242.34unknown [Lotus japonicus][more]
gi|595875888|ref|XP_007212196.1|3.347070e-1245.05hypothetical protein PRUPE_ppa012846mg [Prunus per... [more]
gi|502149642|ref|XP_004507610.1|3.539000e-1246.96PREDICTED: cysteine proteinase inhibitor 5-like [C... [more]
gi|565435455|ref|XP_006281295.1|3.612410e-1240.63hypothetical protein CARUB_v10027345mg, partial [C... [more]
gi|297790905|ref|XP_002863337.1|2.208040e-1142.27hypothetical protein ARALYDRAFT_494218 [Arabidopsi... [more]
gi|502181998|ref|XP_004516922.1|3.429380e-1145.12PREDICTED: cysteine proteinase inhibitor 5-like [C... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR020381Proteinase inhibitor I25, cystatin, conserved regionPRODOMPD001231Q8LBN6_ARATH_Q8LBN6;coord: 31..105
score: 1
NoneNo IPR availableGENE3D3.10.450.10no descriptioncoord: 26..104
score: 3
NoneNo IPR availableSUPERFAMILY54403Cystatin/monellincoord: 20..108
score: 7.3

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0013s0060.1 ID=Medtr0013s0060.1|Name=Medtr0013s0060.1|organism=Medicago truncatula|type=mRNA|length=330bp
ATGAGATTCCAATCCCTTGTTCTTATCCTTGTTGTTCTATTTGCCTCAGC
AGCAATCAATCAAGCTGACTTTGTAGACTTCAATGATCCACATGTGATTG
AAGTCGCCACTTTTGCTGTTACTGAGTACAACAATCAACATACTGAGGCA
AAACTGGTATTCGAGAAAGTCATCAGTGGTGTATCCAATGTTGTCGATAA
TGGGACTAGATATAGCCTCACACTTTCCGCTAATAATCATTCATCTTCTA
ACAATTATGACACAATTGTTTTGGAGAAGTCATCGAAGAATTTTAGCCTT
ATTGCCTTTGCACCTATTCCTCATGCTTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR020381Proteinase inhibitor I25, cystatin, conserved region
noIPRunintegrated
Vocabulary: Cellular Component
TermDefinition
GO:0005575cellular_component
GO:0005618cell wall
GO:0005623cell
GO:0030312external encapsulating structure
GO:0044464cell part
GO:0071944cell periphery