Overview
NameMedtr0012s0290.1
Unique NameMedtr0012s0290.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length4200
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0006820 anion transport
biological_process GO:0008150 biological_process
biological_process GO:0046713 borate transport
biological_process GO:0006952 defense response
biological_process GO:0051234 establishment of localization
biological_process GO:0045087 innate immune response
biological_process GO:0006811 ion transport
biological_process GO:0051179 localization
biological_process GO:0007165 signal transduction
biological_process GO:0044699 single-organism process
biological_process GO:0044765 single-organism transport
biological_process GO:0006810 transport
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0031224 intrinsic component of membrane
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
molecular_function GO:0004888 transmembrane signaling receptor activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00560.28212712-212659650-6671-1710.10.0003335.23.7e-09
PF00931.17214092-213310190-4503-268122.09.3e-39123.18.4e-36
PF01582.15214626-21426412-1321-125104.01.9e-33105.61.2e-30
PF05729.7214044-213610206-3502-16132.03.8e-1133.52.6e-08
PF13676.1214626-21432412-1121-9149.61.6e-1651.01.1e-13

Homology
BLAST of Medtr0012s0290.1 vs. NCBI nr
Match: gi|351722733|ref|NP_001237766.1| (functional candidate resistance protein KR1 [Glycine max] >gi|18033111|gb|AAL56987.1|AF327903_1 functional candidate resistance protein KR1 [Glycine max])
BLAST of Medtr0012s0290.1 vs. NCBI nr
Match: gi|356570357|ref|XP_003553356.1| (PREDICTED: TMV resistance protein N-like [Glycine max])
BLAST of Medtr0012s0290.1 vs. NCBI nr
Match: gi|356573485|ref|XP_003554889.1| (PREDICTED: TMV resistance protein N-like [Glycine max])
BLAST of Medtr0012s0290.1 vs. NCBI nr
Match: gi|356570335|ref|XP_003553345.1| (PREDICTED: TMV resistance protein N-like [Glycine max])
BLAST of Medtr0012s0290.1 vs. NCBI nr
Match: gi|356561802|ref|XP_003549167.1| (PREDICTED: TMV resistance protein N-like [Glycine max])
BLAST of Medtr0012s0290.1 vs. NCBI nr
Match: gi|358248732|ref|NP_001239675.1| (TMV resistance protein N-like [Glycine max] >gi|295083323|gb|ADF78115.1| rj2 protein [Glycine max] >gi|295083325|gb|ADF78116.1| rj2 protein [Glycine max] >gi|295083327|gb|ADF78117.1| rj2 protein [Glycine max] >gi|308171400|gb|ADO15994.1| Rj2/Rfg1 protein [Glycine max])
BLAST of Medtr0012s0290.1 vs. NCBI nr
Match: gi|356561225|ref|XP_003548883.1| (PREDICTED: TMV resistance protein N-like [Glycine max])
BLAST of Medtr0012s0290.1 vs. NCBI nr
Match: gi|502163309|ref|XP_004512798.1| (PREDICTED: TMV resistance protein N-like isoform X2 [Cicer arietinum])
BLAST of Medtr0012s0290.1 vs. NCBI nr
Match: gi|502163306|ref|XP_004512797.1| (PREDICTED: TMV resistance protein N-like isoform X1 [Cicer arietinum])
BLAST of Medtr0012s0290.1 vs. NCBI nr
Match: gi|356561218|ref|XP_003548880.1| (PREDICTED: TMV resistance protein N-like [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0012s0290.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|351722733|ref|NP_001237766.1|0.000000e+048.52functional candidate resistance protein KR1 [Glyci... [more]
gi|356570357|ref|XP_003553356.1|0.000000e+048.92PREDICTED: TMV resistance protein N-like [Glycine ... [more]
gi|356573485|ref|XP_003554889.1|0.000000e+049.91PREDICTED: TMV resistance protein N-like [Glycine ... [more]
gi|356570335|ref|XP_003553345.1|0.000000e+047.53PREDICTED: TMV resistance protein N-like [Glycine ... [more]
gi|356561802|ref|XP_003549167.1|0.000000e+047.53PREDICTED: TMV resistance protein N-like [Glycine ... [more]
gi|358248732|ref|NP_001239675.1|0.000000e+048.50TMV resistance protein N-like [Glycine max] >gi|29... [more]
gi|356561225|ref|XP_003548883.1|0.000000e+048.00PREDICTED: TMV resistance protein N-like [Glycine ... [more]
gi|502163309|ref|XP_004512798.1|5.319090e-15659.58PREDICTED: TMV resistance protein N-like isoform X... [more]
gi|502163306|ref|XP_004512797.1|1.910930e-17459.58PREDICTED: TMV resistance protein N-like isoform X... [more]
gi|356561218|ref|XP_003548880.1|0.000000e+047.20PREDICTED: TMV resistance protein N-like [Glycine ... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000157Toll-Interleukin receptorSMARTSM00255no descriptioncoord: 9..145
score: 1.1
IPR000157Toll-Interleukin receptorPROFILEPS50104TIRcoord: 8..145
score: 24
IPR000157Toll-Interleukin receptorSUPERFAMILY52200Toll/Interleukin receptor TIR domaincoord: 2..148
score: 1
IPR000767Disease resistance proteinPRINTSPR00364DISEASERSISTcoord: 206..221
score: 1e-20coord: 281..295
score: 1e-20coord: 381..395
score: 1e-20coord: 599..615
score: 1
NoneNo IPR availableGENE3D3.40.50.10140no descriptioncoord: 6..129
score: 2.7
NoneNo IPR availableGENE3D3.40.50.300no descriptioncoord: 180..326
score: 6.5
NoneNo IPR availableGENE3D3.80.10.10no descriptioncoord: 550..708
score: 3.1e-12coord: 709..869
score: 1.2
NoneNo IPR availableSEGsegsegcoord: 277..291
score: NAcoord: 1055..1062
score: NAcoord: 1064..1077
score: NAcoord: 1108..1131
score: NAcoord: 1160..1173
score: NAcoord: 1193..1204
score: NAcoord: 1216..1227
score
NoneNo IPR availableSUPERFAMILY46785"Winged helix" DNA-binding domaincoord: 416..524
score: 2.1
NoneNo IPR availableSUPERFAMILY52058L domain-likecoord: 498..898
score: 2.1
NoneNo IPR availableSUPERFAMILY52540P-loop containing nucleoside triphosphate hydrolasescoord: 165..418
score: 2.2

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0012s0290.1 ID=Medtr0012s0290.1|Name=Medtr0012s0290.1|organism=Medicago truncatula|type=mRNA|length=4200bp
ATGGCTTCCGTTAATCAAGAATTTAAGTACGACGTGTTCCTTAGTTTTAG
AGGCGAGGATACTCGTTATGGTTTCACCGGTCATCTTTGGAAAGCTCTTG
ATGACAAAGGAGTCCGAACTTTCATGGATGACGGCAAGCTTCAGAAAGGA
GATGAAATTACACCATCACTTTTCAAGGCAATTGATGAATCCAAGATCGC
CATAGTTGTCCTCTCTAAGAATTACGCTTCTTCATCCTTTTGCTTACAAG
AACTTTCAAAGATCCTTGATACAATGAAAGATAAGGCGGGTCATTCCGTT
TTTCCGGTATTTTATAAGGTGGATCCTTCTGATATACGAAAGTTGAAAAG
AAGTTTTGGAGAAGCAATGGATAAACATAAGGCCAACTCCAGTTTGGATA
AATGGAAGGTGTCTCTTCACCAAGTTGCTGATTTGTCCGGCTTTCATTAC
AAAGGGGATATGCCTGAGCATAAGTTTATTGGGGAGATTGTTGAACAAGT
ATTGGGAATTATAAAACTTGTTTCCTTACATGTTGGTGATTACCTAGTTG
GACTGGATCACCAAAAGCAACATGTGACTTCCCTTTTGAATTTTGGGTCA
GATGATACGGTCCACATGGTAGCAATCCATGGGATTGGTGGAATAGGGAA
AACAACTCTTGCTATATCTGTGTATAATTTGATTGCCCATCAATTTGATG
TTTCATGTTTTCTTGAAAATGTTAGAGAAAATCATGAAAAACATGGGTTA
CCATATCTCCAAAAAATCATTCTTTCAAAAGTAGCTGAGGAGAAAAAGGA
GTTAACAGGTGTTCTCCAAGGAATTTCAATATTGGAGCAGAGGCTCAAAC
AAAAGAAGTTACTTTTGATTCTAGATGATGTTAACAAATTAGAGCAATTA
GAAGCTCTGGCTGGAAAACACAAATGGTTTGGCCCCTCAAGTCGAATCAT
CATTACAACTCGGGACAAAAAGTTGCTAACATGTCATGGGGTTGAACGCA
CATATGAGGTGAATGGGTTGAATGACAAAGATGCTTTGGAGTTGGTTAGA
TGGAAAGCTTTTAAAGATGAATTTAGTCCAAGCTGCAATAACAATGTTTC
ATTAGCACAAATGCATGTTTTAGAACGTGTCGTAGCATATGCTTCTGGTC
ATCCACTTGCTTTGGAGGTCATGGGTTCTCACTTTTATAATAAGACAATA
GAACAATGTAAAGTTGCACTAGATCATTATGAAAAAGTTCCTCATAAAAA
GATCCAAACGACACTACAACTGAGCTTTGATGCTTTGGAGGACAAAGATA
AATTTGTTTTTCTTGACATTGCTTGTTGCTTCAAAGGATGGAAATTAACA
AGGGTCGAAGAAATACTTCATGCTCAGTACGGTAATATCATGAAAGATAA
CATTAATGTGTTAGTGGAAAAATCTCTCATAAAGATAAGTGAGTCTGGTA
ATGTGACAATGCATGATTTGGTAGAAGATATGGGGAAAGAAATTGTTAGA
CAAGAATCACCTGAAAATCCTGGAAAACGCAGTAGATTATGGTTCTCTGA
AGATATAATGCACGTTTTAGAGGAAAATACAGGAACAAATCAAATAGAAA
TCATACGTTTCGATTGTTGGACTAGAGTAGCATGGGATGGAGAAGCTTTC
AAGAAGATGGAAAATCTCAAAACACTAATTTTTTCTGATTATGTTTTCTT
TAAAAAACATCCCAAACATCTTCCAAATAGTCTAAGAGTGCTGGAATGTC
GCTATCCTTCATCAGGTTGCAGGAAGCTAAGGAGTATTCCACCTCTCAAG
TTGAATTCGCTAGAAACCCTTGATTTTTCATCTTGTCATAGGCTCGAGAG
TTTTCCACTTGTGGTGAACGGGTTTCTTGGAAAACTTAAAACCCTGCTTG
TTACAAATTGTTACAATCTTAAGAGCATCCCACCTCTCAAGTTGGATTCA
TTAGAAGTACTTGACCTTTCATGTTGTTGTAGTCTTGAAAGTTTTCCATG
TGTGGTGGATGAGTTGTTGGATAAACTTAAATTCTTGAACATTGAATGTT
GCATCATGCTTAGGAATATCCCGCGGCTTAGGTTGACTTCATTGGAACAT
TTCAATCTTTCATATTGTTATAGTCTCAAGAGTTTTCCAGAAATATTGGG
AGAGATGAGAAATATGCCAGGAGTCCTCATGGATGAAACTCCCATAAAAG
AATTGCCGTTTCCATTTAAAAATCTTACCCAACCTAAAACATTATGTGAA
TGTGGATATGTTTACTTACCAAATAGGATGTCAACACTGGCTGAATTTAC
CATCAAGAATGAAGAAAAAGTGAACACAATGCAATCTTTACATGTAAAGT
ATATTTGTGTCAGGAGGTGCAATCTTTCAGATGAATATCTGTCAAAAAGT
CTTATGTTATTTGCTAATGTGAAAGAATTACACCTAACTAGTAATCACTT
CACAGTAATTCCTAAATCTATCGAATATTGTAAATCTTTGTGGAAACTCG
TCTTGGATGATTGTAAGGCACTTCAAGAAATTAAAGGGATTCCTCCATGC
TTAAGAATGTTATCTGCACTAAACTGCATATCATTGACTTCGTCGTGCAA
AAGCAAATTACTAAATCAGGAATTACATGAGGCTGGAAACACTTGGTTTC
GTTTGCCACGAGCGACATTTCCAGAGTGGTTCGACCACCACTGTTTGGCA
AGATTGTCATTTTCTTTCTGGTTTCGTAACAAGTTTCCTGCCATAGCTCT
CTGTGTTGTTTGTTCATCGACATTGCACGATTCTCAACGTCCTGTAAGAG
TGGTCATCAATGGCAATACATTTTTCTATACACATGATTCGAAGATAGAT
AGGTCATCACGGCCGGACATGTATCATTTGCATCTTTTTCATATGCAAAT
GGAAAACTTCAATGAAAATATGGACAAAGCACTCTCAGAAAATAAGTGGA
ATCATGCAGAGCTTGATTTTGGACTCTCATTCCTGGAAAGTGGAATCCAT
GTATTGAAAGAGAGAAGTAGCATGAACGATATTCGATTCATCAACCCAAA
GTATGATGTGTTCACTCGGGATTTTGAAGTTACTGATCTTCCACAGGCCA
TGCTACCACCAGAGTCCTTTAACTTGTCAGCAGAACTTTCATCAACTTCC
AATGAAATTGCACCGTTGCTGAACAACTTACCTTTGAGATCATCTTCTAA
AAGGCACTTTTCTCATAAGAAAGAACACCATTGCTTGATTATAAAAAAGA
AAAGAATTGTTGAGTTAATTGAATCCCAAACAGGAGCTCTTGATAAATTT
ATTGTAAAAGAAACGCAAGTTCCTATTGATGATAATGCTATTTCTATTGA
TGATAATATTGATGCTATTCCTATTGATGCTATTCCTGATAATGTTGGTG
CATGGCTTTTGGTGCACGAAGATGTTTCAACTGAGAATGAGGAATTTAGT
GAGATTGTTGAGGAAGGAGTTGATCAAACTGAGGAAGGTACAACATTGGA
AGGATGTGGTGAATTTGAAATTGCACAAGAAATAGACACATCGCACAAAG
ACGAATTTCCTCAAGAACGACCATATACTGAAGAGGCCGAAACTGTTGAA
AATGAAGAAGTGATGCAGGTGACAGAGAAAACGGAACGGATACTAAGCAA
GGAAGAATCAATGGAAGGAAAGGGGAAGAAAGTGAACAAGGTGGAGATTG
ATCGGGTCATAGATGAGATATGTGCCTTGTTCAACAAACCAACGTTAGGG
AGGATATGGACTCCACATCAGCTGTACCTAAAGTTTATGGAATTCCTCCC
AAAGCGAGCACATACTCGCCCTGGCGAGTGTTTCATGCCTTTGACCTGCA
TTGACCACCAAATTGCTCGCCATAGCGAGCATATTCTCGCGAGTCGAGTT
GCAGTAGATCTTAGGCCAGCAAATCCACATCAGGTGCATGGTGATGATAC
ATATTGTTTGAATTGCTCAAAGCCAAGGTATAAGTTTCTTGCTTTTCTAG
GAATTGAGTGCCAAAACATCAAGCAAGGACCAAAAAGAATAAAATTGGGC
AAAAGCTACTTCACCATGGTGAGTAGAAATCCTGCCAGGAGAAATATTTC
ACCAGGCGAGCCAAACATCGAGCAGTTCCAGAGAGTTGGAAAAACAGGAC
AAGAGCACTTCGCCATAGTATGTATTCCCTTTGATTTGGATGTTGTGTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000157Toll-Interleukin receptor
IPR000767Disease resistance protein
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0004888transmembrane signaling receptor activity
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Biological Process
TermDefinition
GO:0007165signal transduction
GO:0045087innate immune response
GO:0006952defense response
GO:0006810transport
GO:0006811ion transport
GO:0006820anion transport
GO:0008150biological_process
GO:0044699single-organism process
GO:0044765single-organism transport
GO:0046713borate transport
GO:0051179localization
GO:0051234establishment of localization
Vocabulary: Cellular Component
TermDefinition
GO:0031224intrinsic component of membrane
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005634nucleus
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part