Overview
NameMedtr0012s0110.1
Unique NameMedtr0012s0110.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length612
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0016070 RNA metabolic process
biological_process GO:0006396 RNA processing
biological_process GO:0008380 RNA splicing
biological_process GO:0000375 RNA splicing, via transesterification reactions
biological_process GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile
biological_process GO:0008150 biological_process
biological_process GO:0006725 cellular aromatic compound metabolic process
biological_process GO:0044260 cellular macromolecule metabolic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0034641 cellular nitrogen compound metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0010467 gene expression
biological_process GO:0046483 heterocycle metabolic process
biological_process GO:0016071 mRNA metabolic process
biological_process GO:0006397 mRNA processing
biological_process GO:0000398 mRNA splicing, via spliceosome
biological_process GO:0043170 macromolecule metabolic process
biological_process GO:0008152 metabolic process
biological_process GO:0006807 nitrogen compound metabolic process
biological_process GO:0090304 nucleic acid metabolic process
biological_process GO:0006139 nucleobase-containing compound metabolic process
biological_process GO:1901360 organic cyclic compound metabolic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0044238 primary metabolic process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF08799.646266-46177140-1691-3048.13.1e-1748.82.5e-13

Homology
BLAST of Medtr0012s0110.1 vs. NCBI nr
Match: gi|502179061|ref|XP_004516365.1| (PREDICTED: U4/U6 small nuclear ribonucleoprotein PRP4-like protein-like isoform X2 [Cicer arietinum])
BLAST of Medtr0012s0110.1 vs. NCBI nr
Match: gi|502179056|ref|XP_004516364.1| (PREDICTED: U4/U6 small nuclear ribonucleoprotein PRP4-like protein-like isoform X1 [Cicer arietinum])
BLAST of Medtr0012s0110.1 vs. NCBI nr
Match: gi|356500553|ref|XP_003519096.1| (PREDICTED: U4/U6 small nuclear ribonucleoprotein PRP4-like protein-like isoform X1 [Glycine max] >gi|571440827|ref|XP_006575267.1| PREDICTED: U4/U6 small nuclear ribonucleoprotein PRP4-like protein-like isoform X2 [Glycine max] >gi|571440829|ref|XP_006575268.1| PREDICTED: U4/U6 small nuclear ribonucleoprotein PRP4-like protein-like isoform X3 [Glycine max])
BLAST of Medtr0012s0110.1 vs. NCBI nr
Match: gi|590688519|ref|XP_007042972.1| (WD-40 repeat family protein / small nuclear ribonucleoprotein Prp4p-related [Theobroma cacao] >gi|508706907|gb|EOX98803.1| WD-40 repeat family protein / small nuclear ribonucleoprotein Prp4p-related [Theobroma cacao])
BLAST of Medtr0012s0110.1 vs. NCBI nr
Match: gi|356534706|ref|XP_003535893.1| (PREDICTED: U4/U6 small nuclear ribonucleoprotein PRP4-like protein-like [Glycine max])
BLAST of Medtr0012s0110.1 vs. NCBI nr
Match: gi|395146482|gb|AFN53638.1| (hypothetical protein [Linum usitatissimum])
BLAST of Medtr0012s0110.1 vs. NCBI nr
Match: gi|224090045|ref|XP_002308919.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0012s0110.1 vs. NCBI nr
Match: gi|449505667|ref|XP_004162536.1| (PREDICTED: U4/U6 small nuclear ribonucleoprotein PRP4-like protein-like [Cucumis sativus])
BLAST of Medtr0012s0110.1 vs. NCBI nr
Match: gi|449458027|ref|XP_004146749.1| (PREDICTED: U4/U6 small nuclear ribonucleoprotein PRP4-like protein-like [Cucumis sativus])
BLAST of Medtr0012s0110.1 vs. NCBI nr
Match: gi|460381681|ref|XP_004236572.1| (PREDICTED: U4/U6 small nuclear ribonucleoprotein PRP4-like protein-like [Solanum lycopersicum])
The following BLAST results are available for this feature:
BLAST of Medtr0012s0110.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502179061|ref|XP_004516365.1|6.521340e-8084.04PREDICTED: U4/U6 small nuclear ribonucleoprotein P... [more]
gi|502179056|ref|XP_004516364.1|8.483460e-8084.04PREDICTED: U4/U6 small nuclear ribonucleoprotein P... [more]
gi|356500553|ref|XP_003519096.1|2.033340e-6867.61PREDICTED: U4/U6 small nuclear ribonucleoprotein P... [more]
gi|590688519|ref|XP_007042972.1|1.457640e-6071.33WD-40 repeat family protein / small nuclear ribonu... [more]
gi|356534706|ref|XP_003535893.1|1.079740e-5564.52PREDICTED: U4/U6 small nuclear ribonucleoprotein P... [more]
gi|395146482|gb|AFN53638.1|3.704130e-5565.38hypothetical protein [Linum usitatissimum][more]
gi|224090045|ref|XP_002308919.1|7.389720e-5571.03predicted protein [Populus trichocarpa][more]
gi|449505667|ref|XP_004162536.1|9.043050e-5458.73PREDICTED: U4/U6 small nuclear ribonucleoprotein P... [more]
gi|449458027|ref|XP_004146749.1|1.210610e-5358.42PREDICTED: U4/U6 small nuclear ribonucleoprotein P... [more]
gi|460381681|ref|XP_004236572.1|8.714130e-4669.13PREDICTED: U4/U6 small nuclear ribonucleoprotein P... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR003648Splicing factor motifSMARTSM00500no descriptioncoord: 135..188
score: 5.2
NoneNo IPR availableCOILcoilcoiled-coilcoord: 171..192
score
NoneNo IPR availableSEGsegsegcoord: 80..89
score: NAcoord: 122..132
score: NAcoord: 156..169
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0012s0110.1 ID=Medtr0012s0110.1|Name=Medtr0012s0110.1|organism=Medicago truncatula|type=mRNA|length=612bp
ATGGAAGTGGAGATGGAAAATTCAACAACGACTGAATCGTCTGTACCTGG
TTCTGATGTTCAAGATCAAAACCCTCTAGTTTCGTCCCAGCCAACTCAAC
CACCGGTTATTACTCCTGTCTTGCCATCTCTGGCTCCAATTCCTACAGCT
CCTTCCTCTCTTGTCCGACCTCTGGCACCGCTCCCAATGCGCCCACTGGT
TATTAGGCCGCCGATACCGCAAAATGGCGAGGTTGGGTCTAGTGATTCTG
ATTCGGACGATGATGATGGTGCAGACACCAGAATTAATAAGGGTACTGGG
GAGTATGAGATATCAGAAGAGAGTAGACTGGTGAGGGAGCGGCATGAGAA
AGCCATGCAAGACCTTATGATGAGGAGGCGAGCTGCTGCTCTTGCTGTTC
CCACCAATGACATGGCAGTCAGGGCCCGTCTTCGCCATCTTGGTGAGCCG
ATTACTCTCTTTGGTGAGAGGGAGATGGAGAGACGAGATAGGTTGCGGAT
GATTATGGCAAAGCTGGATGCTGATGGTCAGCTGGAAAAGCTAATGAAAG
CTCTTGAGGATGAAGAGGCTGCAACTTCTGCTCCAAAAGATGAGGCTGAG
GATGATCTTTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR003648Splicing factor motif
noIPRunintegrated
Vocabulary: Biological Process
TermDefinition
GO:0008380RNA splicing
GO:0000375RNA splicing, via transesterification reactions
GO:0000377RNA splicing, via transesterification reactions with bulged adenosine as nucleophile
GO:0000398mRNA splicing, via spliceosome
GO:0008152metabolic process
GO:0006139nucleobase-containing compound metabolic process
GO:0006396RNA processing
GO:0006397mRNA processing
GO:0006725cellular aromatic compound metabolic process
GO:0006807nitrogen compound metabolic process
GO:0008150biological_process
GO:0009987cellular process
GO:0010467gene expression
GO:0016070RNA metabolic process
GO:0016071mRNA metabolic process
GO:0034641cellular nitrogen compound metabolic process
GO:0043170macromolecule metabolic process
GO:0044237cellular metabolic process
GO:0044238primary metabolic process
GO:0044260cellular macromolecule metabolic process
GO:0046483heterocycle metabolic process
GO:0071704organic substance metabolic process
GO:0090304nucleic acid metabolic process
GO:1901360organic cyclic compound metabolic process
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005634nucleus
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part