Overview
NameMedtr0011s0330.1
Unique NameMedtr0011s0330.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length387
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0043581 mycelium development
biological_process GO:0042254 ribosome biogenesis
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0005622 intracellular
cellular_component GO:0043232 intracellular non-membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0032991 macromolecular complex
cellular_component GO:0043228 non-membrane-bounded organelle
cellular_component GO:0005730 nucleolus
cellular_component GO:0043226 organelle
cellular_component GO:0030529 ribonucleoprotein complex
cellular_component GO:0005840 ribosome
molecular_function GO:0003723 RNA binding
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01248.21248238-24796922-1113-9292.26.8e-3192.57.8e-27

Homology
BLAST of Medtr0011s0330.1 vs. NCBI nr
Match: gi|502087441|ref|XP_004488534.1| (PREDICTED: NHP2-like protein 1-like [Cicer arietinum] >gi|388513781|gb|AFK44952.1| unknown [Medicago truncatula] >gi|657371510|gb|KEH17500.1| ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein [Medicago truncatula])
BLAST of Medtr0011s0330.1 vs. NCBI nr
Match: gi|388517769|gb|AFK46946.1| (unknown [Lotus japonicus])
BLAST of Medtr0011s0330.1 vs. NCBI nr
Match: gi|351727467|ref|NP_001235882.1| (uncharacterized protein LOC100527424 [Glycine max] >gi|593539422|ref|XP_007142301.1| hypothetical protein PHAVU_008G269000g [Phaseolus vulgaris] >gi|255632312|gb|ACU16514.1| unknown [Glycine max] >gi|561015434|gb|ESW14295.1| hypothetical protein PHAVU_008G269000g [Phaseolus vulgaris])
BLAST of Medtr0011s0330.1 vs. NCBI nr
Match: gi|449443099|ref|XP_004139318.1| (PREDICTED: NHP2-like protein 1-like [Cucumis sativus] >gi|449493622|ref|XP_004159380.1| PREDICTED: NHP2-like protein 1-like [Cucumis sativus] >gi|659071006|ref|XP_008457690.1| PREDICTED: NHP2-like protein 1 [Cucumis melo])
BLAST of Medtr0011s0330.1 vs. NCBI nr
Match: gi|351725919|ref|NP_001237109.1| (uncharacterized protein LOC100305817 [Glycine max] >gi|356553100|ref|XP_003544896.1| PREDICTED: NHP2-like protein 1-like [Glycine max] >gi|255626693|gb|ACU13691.1| unknown [Glycine max])
BLAST of Medtr0011s0330.1 vs. NCBI nr
Match: gi|595808382|ref|XP_007202753.1| (hypothetical protein PRUPE_ppa013336mg [Prunus persica] >gi|595849619|ref|XP_007209763.1| hypothetical protein PRUPE_ppa013346mg [Prunus persica] >gi|645264895|ref|XP_008237895.1| PREDICTED: NHP2-like protein 1 [Prunus mume] >gi|645275324|ref|XP_008242760.1| PREDICTED: NHP2-like protein 1 [Prunus mume] >gi|462398284|gb|EMJ03952.1| hypothetical protein PRUPE_ppa013336mg [Prunus persica] >gi|462405498|gb|EMJ10962.1| hypothetical protein PRUPE_ppa013346mg [Prunus persica])
BLAST of Medtr0011s0330.1 vs. NCBI nr
Match: gi|356563028|ref|XP_003549768.1| (PREDICTED: NHP2-like protein 1-like [Glycine max])
BLAST of Medtr0011s0330.1 vs. NCBI nr
Match: gi|255566991|ref|XP_002524478.1| (ribosomal protein l7ae, putative [Ricinus communis] >gi|223536266|gb|EEF37918.1| ribosomal protein l7ae, putative [Ricinus communis])
BLAST of Medtr0011s0330.1 vs. NCBI nr
Match: gi|552830761|ref|XP_005847978.1| (ribosomal protein L7 [Chlorella variabilis] >gi|307107634|gb|EFN55876.1| ribosomal protein L7 [Chlorella variabilis])
BLAST of Medtr0011s0330.1 vs. NCBI nr
Match: gi|388507460|gb|AFK41796.1| (unknown [Lotus japonicus])
The following BLAST results are available for this feature:
BLAST of Medtr0011s0330.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502087441|ref|XP_004488534.1|2.109990e-87100.00PREDICTED: NHP2-like protein 1-like [Cicer arietin... [more]
gi|388517769|gb|AFK46946.1|2.159070e-8698.44unknown [Lotus japonicus][more]
gi|351727467|ref|NP_001235882.1|2.600220e-8698.44uncharacterized protein LOC100527424 [Glycine max]... [more]
gi|449443099|ref|XP_004139318.1|5.523430e-8698.44PREDICTED: NHP2-like protein 1-like [Cucumis sativ... [more]
gi|351725919|ref|NP_001237109.1|5.523430e-8698.44uncharacterized protein LOC100305817 [Glycine max]... [more]
gi|595808382|ref|XP_007202753.1|2.496660e-8395.31hypothetical protein PRUPE_ppa013336mg [Prunus per... [more]
gi|356563028|ref|XP_003549768.1|2.387210e-7697.66PREDICTED: NHP2-like protein 1-like [Glycine max][more]
gi|255566991|ref|XP_002524478.1|4.209380e-7697.66ribosomal protein l7ae, putative [Ricinus communis... [more]
gi|552830761|ref|XP_005847978.1|6.668940e-7692.68ribosomal protein L7 [Chlorella variabilis] >gi|30... [more]
gi|388507460|gb|AFK41796.1|7.183360e-7697.66unknown [Lotus japonicus][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR002415H/ACA ribonucleoprotein complex, subunit Nhp2, eukaryotePRINTSPR00883NUCLEARHMGcoord: 8..21
score: 3.4e-27coord: 21..36
score: 3.4e-27coord: 38..48
score: 3.4e-27coord: 82..94
score: 3.4
IPR004037Ribosomal protein L7Ae conserved sitePROSITEPS01082RIBOSOMAL_L7AEcoord: 73..90
score
IPR018492Ribosomal protein L7Ae/L8/Nhp2 familyPRINTSPR00881L7ARS6FAMILYcoord: 35..49
score: 6.7e-20coord: 54..67
score: 6.7e-20coord: 70..80
score: 6.7e-20coord: 80..94
score: 6.7
NoneNo IPR availableGENE3D3.30.1330.30no descriptioncoord: 6..123
score: 8.7
NoneNo IPR availableSEGsegsegcoord: 61..72
score
NoneNo IPR availableSUPERFAMILY55315L30e-likecoord: 4..128
score: 1.8

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0011s0330.1 ID=Medtr0011s0330.1|Name=Medtr0011s0330.1|organism=Medicago truncatula|type=mRNA|length=387bp
ATGACTGGAGAAACAGTGAATCCAAAAGCTTACCCTTTGGCGGATGCACA
ACTTACGATAACGATAATGGATCTTGTTCAACAAGCTGCTAATTACAAGC
AACTCAAAAAGGGTGCCAATGAAGCTACGAAGACACTTAACAGAGGCATT
TCTGAGTTTGTTGTGATGGCTGCAGACACTGAACCACTTGAGATTCTTCT
TCATCTTCCTTTGCTTGCTGAGGATAAGAATGTTCCTTATGTATTTGTCC
CATCAAAACAAGCACTTGGACGCGCATGCGGTGTGACCCGGCCAGTGATT
GCATGTTCTGTGACAACCAATGAGGGAAGTCAACTCAAATCTCAAATACA
GCAACTGAAGGATGCTATTGAGAAACTATTGATCTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR002415H/ACA ribonucleoprotein complex, subunit Nhp2, eukaryote
IPR004037Ribosomal protein L7Ae conserved site
IPR018492Ribosomal protein L7Ae/L8/Nhp2 family
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0003723RNA binding
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005730nucleolus
GO:0030529ribonucleoprotein complex
GO:0005622intracellular
GO:0005575cellular_component
GO:0005840ribosome
GO:0005623cell
GO:0005737cytoplasm
GO:0032991macromolecular complex
GO:0043226organelle
GO:0043228non-membrane-bounded organelle
GO:0043229intracellular organelle
GO:0043232intracellular non-membrane-bounded organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0042254ribosome biogenesis
GO:0007275multicellular organismal development
GO:0008150biological_process
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0043581mycelium development
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048856anatomical structure development