Overview
NameMedtr0011s0310.1
Unique NameMedtr0011s0310.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length318
Homology
BLAST of Medtr0011s0310.1 vs. NCBI nr
Match: gi|356510507|ref|XP_003523979.1| (PREDICTED: LOW QUALITY PROTEIN: xylosyltransferase 2-like [Glycine max])
BLAST of Medtr0011s0310.1 vs. NCBI nr
Match: gi|502151573|ref|XP_004508507.1| (PREDICTED: xylosyltransferase 1-like [Cicer arietinum])
BLAST of Medtr0011s0310.1 vs. NCBI nr
Match: gi|356514479|ref|XP_003525933.1| (PREDICTED: xylosyltransferase 1-like [Glycine max])
BLAST of Medtr0011s0310.1 vs. NCBI nr
Match: gi|356548587|ref|XP_003542682.1| (PREDICTED: xylosyltransferase 2-like isoform X1 [Glycine max])
BLAST of Medtr0011s0310.1 vs. NCBI nr
Match: gi|388493672|gb|AFK34902.1| (unknown [Lotus japonicus])
BLAST of Medtr0011s0310.1 vs. NCBI nr
Match: gi|356565185|ref|XP_003550824.1| (PREDICTED: xylosyltransferase 2-like [Glycine max])
BLAST of Medtr0011s0310.1 vs. NCBI nr
Match: gi|225445480|ref|XP_002285159.1| (PREDICTED: xylosyltransferase 1-like [Vitis vinifera])
BLAST of Medtr0011s0310.1 vs. NCBI nr
Match: gi|460412346|ref|XP_004251562.1| (PREDICTED: xylosyltransferase 2-like [Solanum lycopersicum])
BLAST of Medtr0011s0310.1 vs. NCBI nr
Match: gi|595804436|ref|XP_007202155.1| (hypothetical protein PRUPE_ppa006279mg [Prunus persica] >gi|462397686|gb|EMJ03354.1| hypothetical protein PRUPE_ppa006279mg [Prunus persica])
BLAST of Medtr0011s0310.1 vs. NCBI nr
Match: gi|147810326|emb|CAN65025.1| (hypothetical protein VITISV_026274 [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0011s0310.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356510507|ref|XP_003523979.1|8.951810e-3059.22PREDICTED: LOW QUALITY PROTEIN: xylosyltransferase... [more]
gi|502151573|ref|XP_004508507.1|3.046770e-2651.79PREDICTED: xylosyltransferase 1-like [Cicer arieti... [more]
gi|356514479|ref|XP_003525933.1|3.229210e-2655.34PREDICTED: xylosyltransferase 1-like [Glycine max][more]
gi|356548587|ref|XP_003542682.1|3.514650e-2550.00PREDICTED: xylosyltransferase 2-like isoform X1 [G... [more]
gi|388493672|gb|AFK34902.1|6.855630e-2553.40unknown [Lotus japonicus][more]
gi|356565185|ref|XP_003550824.1|1.788860e-2450.91PREDICTED: xylosyltransferase 2-like [Glycine max][more]
gi|225445480|ref|XP_002285159.1|1.871550e-2045.95PREDICTED: xylosyltransferase 1-like [Vitis vinife... [more]
gi|460412346|ref|XP_004251562.1|4.940920e-2045.05PREDICTED: xylosyltransferase 2-like [Solanum lyco... [more]
gi|595804436|ref|XP_007202155.1|1.385370e-1950.00hypothetical protein PRUPE_ppa006279mg [Prunus per... [more]
gi|147810326|emb|CAN65025.1|1.402710e-1848.35hypothetical protein VITISV_026274 [Vitis vinifera... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0011s0310.1 ID=Medtr0011s0310.1|Name=Medtr0011s0310.1|organism=Medicago truncatula|type=mRNA|length=318bp
ATGAATCACGACCACCATTTCATGGAACAACCTTCCAAAAGAACACCCAG
CAATGCTCCTTTTGCTAGAAAATTTGTCAGGAATGTACCTGTCTTCAATA
AGATTGATGCCGAACTCTTGGGACGAAATGCAGATGGTTGCATGCCTAAT
ATGTGGTTTAGTCAAGCAAATTCAAGCGTCACTAAACAGCATTCTGCTGT
GAGAAATATCACCGAACTTAGGCTTGGTCCTGGAGCTGAAAGGCTCAAAC
ATCGTATTGATGGTTATTATCGGCACAAGATTTTCACGCAAATGAGTGTT
CTTAACACCCATGTTTGA
back to top