Overview
NameMedtr0011s0270.1
Unique NameMedtr0011s0270.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length555
Homology
BLAST of Medtr0011s0270.1 vs. NCBI nr
Match: gi|332322201|emb|CCA66222.1| (hypothetical protein [Beta vulgaris subsp. vulgaris])
BLAST of Medtr0011s0270.1 vs. NCBI nr
Match: gi|356515310|ref|XP_003526344.1| (PREDICTED: uncharacterized protein LOC100799415 [Glycine max])
BLAST of Medtr0011s0270.1 vs. NCBI nr
Match: gi|332322180|emb|CCA66188.1| (hypothetical protein [Beta vulgaris subsp. vulgaris])
BLAST of Medtr0011s0270.1 vs. NCBI nr
Match: gi|356560755|ref|XP_003548653.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Glycine max])
BLAST of Medtr0011s0270.1 vs. NCBI nr
Match: gi|332322174|emb|CCA66180.1| (hypothetical protein [Beta vulgaris subsp. vulgaris])
BLAST of Medtr0011s0270.1 vs. NCBI nr
Match: gi|332322171|emb|CCA66178.1| (hypothetical protein [Beta vulgaris subsp. vulgaris])
BLAST of Medtr0011s0270.1 vs. NCBI nr
Match: gi|356560989|ref|XP_003548768.1| (PREDICTED: uncharacterized protein LOC100775187 [Glycine max])
BLAST of Medtr0011s0270.1 vs. NCBI nr
Match: gi|332322082|emb|CCA65974.1| (hypothetical protein [Beta vulgaris subsp. vulgaris])
BLAST of Medtr0011s0270.1 vs. NCBI nr
Match: gi|356565386|ref|XP_003550922.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Glycine max])
BLAST of Medtr0011s0270.1 vs. NCBI nr
Match: gi|590610202|ref|XP_007021749.1| (Uncharacterized protein TCM_031793 [Theobroma cacao] >gi|508721377|gb|EOY13274.1| Uncharacterized protein TCM_031793 [Theobroma cacao])
The following BLAST results are available for this feature:
BLAST of Medtr0011s0270.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|332322201|emb|CCA66222.1|4.812570e-1352.17hypothetical protein [Beta vulgaris subsp. vulgari... [more]
gi|356515310|ref|XP_003526344.1|2.698750e-1245.59PREDICTED: uncharacterized protein LOC100799415 [G... [more]
gi|332322180|emb|CCA66188.1|3.663320e-1147.83hypothetical protein [Beta vulgaris subsp. vulgari... [more]
gi|356560755|ref|XP_003548653.1|1.156000e-1034.82PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|332322174|emb|CCA66180.1|1.362100e-1047.76hypothetical protein [Beta vulgaris subsp. vulgari... [more]
gi|332322171|emb|CCA66178.1|2.364170e-1049.21hypothetical protein [Beta vulgaris subsp. vulgari... [more]
gi|356560989|ref|XP_003548768.1|3.208220e-1040.26PREDICTED: uncharacterized protein LOC100775187 [G... [more]
gi|332322082|emb|CCA65974.1|5.791940e-1052.54hypothetical protein [Beta vulgaris subsp. vulgari... [more]
gi|356565386|ref|XP_003550922.1|7.016680e-1043.28PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|590610202|ref|XP_007021749.1|1.853610e-950.00Uncharacterized protein TCM_031793 [Theobroma caca... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 162..168
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0011s0270.1 ID=Medtr0011s0270.1|Name=Medtr0011s0270.1|organism=Medicago truncatula|type=mRNA|length=555bp
ATGGAGATCGGAATGTTTAAGTACTTCTTTCGTTTCAGTGTTGGCAATGG
TAGTCCTACAAAAGAATTTCAGTTGGGAGTACTGGAGATGGGGAAGTTCA
CTTGGCTCAAATTTGATTTGGGTGACAAACGTCTTACTCAGCTTCAGTAT
GCAGACGACATTTTGATCAAACATAGATGGCTCTTAGAGGCGGCAAACAT
TTTGAACTGCAAATTAGGCCCCACTCCTTTTAAGTATCTTAGTCTTCCAA
TTGGAGCTAATCTAAATAGAAGAGATATGTGGCACCCAGTGATTGGGGCG
ATGAGATCTAGATTGTCAAGTTGGAGGAATAAACAGTTGTCCATCGGTGG
TCGTGTGTTTACAATCTTCATTACTTGGTGGTTAAAATTTTTGGGAATTA
GACAAAGTGTTGGAAAAAGTGAGATAACTGGGCAAAAGTCTGGTGGAGCT
AGCATGGACATTTTGGCCACAACTAGTTTGAAGGGGGGTGGAGGAAGCGG
TGGTGTCATCCCTCGAATCATTTTGCGATGGAGATTTACTGCAAACAACA
GTTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated