Overview
NameMedtr0011s0260.1
Unique NameMedtr0011s0260.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1083
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0009812 flavonoid metabolic process
biological_process GO:0008152 metabolic process
biological_process GO:0071704 organic substance metabolic process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
molecular_function GO:0003674 molecular_function
molecular_function GO:0001071 nucleic acid binding transcription factor activity
molecular_function GO:0003700 sequence-specific DNA binding transcription factor activity
molecular_function GO:0030528 transcription regulator activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00010.21221219-221353184-2285-5332.82.7e-1233.62e-08

Homology
BLAST of Medtr0011s0260.1 vs. NCBI nr
Match: gi|502152673|ref|XP_004509037.1| (PREDICTED: transcription factor NAI1-like [Cicer arietinum])
BLAST of Medtr0011s0260.1 vs. NCBI nr
Match: gi|356563474|ref|XP_003549987.1| (PREDICTED: transcription factor bHLH18-like [Glycine max])
BLAST of Medtr0011s0260.1 vs. NCBI nr
Match: gi|356512000|ref|XP_003524709.1| (PREDICTED: LOW QUALITY PROTEIN: transcription factor bHLH25-like [Glycine max])
BLAST of Medtr0011s0260.1 vs. NCBI nr
Match: gi|255647602|gb|ACU24264.1| (unknown [Glycine max])
BLAST of Medtr0011s0260.1 vs. NCBI nr
Match: gi|223702420|gb|ACN21641.1| (putative basic helix-loop-helix protein BHLH17 [Lotus japonicus])
BLAST of Medtr0011s0260.1 vs. NCBI nr
Match: gi|356495529|ref|XP_003516629.1| (PREDICTED: LOW QUALITY PROTEIN: transcription factor bHLH25-like [Glycine max])
BLAST of Medtr0011s0260.1 vs. NCBI nr
Match: gi|590706230|ref|XP_007047665.1| (Basic helix-loop-helix DNA-binding superfamily protein, putative [Theobroma cacao] >gi|508699926|gb|EOX91822.1| Basic helix-loop-helix DNA-binding superfamily protein, putative [Theobroma cacao])
BLAST of Medtr0011s0260.1 vs. NCBI nr
Match: gi|502160575|ref|XP_004511793.1| (PREDICTED: transcription factor bHLH18-like [Cicer arietinum])
BLAST of Medtr0011s0260.1 vs. NCBI nr
Match: gi|147818973|emb|CAN67117.1| (hypothetical protein VITISV_026466 [Vitis vinifera])
BLAST of Medtr0011s0260.1 vs. NCBI nr
Match: gi|359480528|ref|XP_002270448.2| (PREDICTED: transcription factor bHLH25-like [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0011s0260.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502152673|ref|XP_004509037.1|8.424300e-12457.57PREDICTED: transcription factor NAI1-like [Cicer a... [more]
gi|356563474|ref|XP_003549987.1|1.530990e-9751.57PREDICTED: transcription factor bHLH18-like [Glyci... [more]
gi|356512000|ref|XP_003524709.1|1.038250e-8447.20PREDICTED: LOW QUALITY PROTEIN: transcription fact... [more]
gi|255647602|gb|ACU24264.1|8.000130e-7663.92unknown [Glycine max][more]
gi|223702420|gb|ACN21641.1|4.649460e-7043.75putative basic helix-loop-helix protein BHLH17 [Lo... [more]
gi|356495529|ref|XP_003516629.1|2.657080e-6239.61PREDICTED: LOW QUALITY PROTEIN: transcription fact... [more]
gi|590706230|ref|XP_007047665.1|8.805090e-6239.84Basic helix-loop-helix DNA-binding superfamily pro... [more]
gi|502160575|ref|XP_004511793.1|4.390000e-6058.97PREDICTED: transcription factor bHLH18-like [Cicer... [more]
gi|147818973|emb|CAN67117.1|1.202750e-5937.94hypothetical protein VITISV_026466 [Vitis vinifera... [more]
gi|359480528|ref|XP_002270448.2|2.443010e-5937.94PREDICTED: transcription factor bHLH25-like [Vitis... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001092Helix-loop-helix DNA-binding domainSMARTSM00353no descriptioncoord: 185..234
score: 6.4
IPR001092Helix-loop-helix DNA-binding domainPROFILEPS50888HLHcoord: 174..229
score: 12
IPR011598Helix-loop-helix DNA-bindingGENE3D4.10.280.10no descriptioncoord: 183..246
score: 1.2
IPR011598Helix-loop-helix DNA-bindingSUPERFAMILY47459HLH, helix-loop-helix DNA-binding domaincoord: 177..261
score: 3.3
NoneNo IPR availableCOILcoilcoiled-coilcoord: 218..246
score
NoneNo IPR availableSEGsegsegcoord: 12..16
score: NAcoord: 65..79
score: NAcoord: 124..142
score: NAcoord: 164..177
score: NAcoord: 226..237
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0011s0260.1 ID=Medtr0011s0260.1|Name=Medtr0011s0260.1|organism=Medicago truncatula|type=mRNA|length=1083bp
ATGGAGGAAATCAACAGCACAGCTATGAACGTATCATCAAGCAGCAGCTG
GTTATCTGATTTGGAAATGGACGAATACAATTTATTTGCTAAGGAATGCA
ACCTGAATTTCCTTGATACTAGTGTGGAAGATTTTCTTTCACATGACATA
ACTATTAATGTCTTCCAAGAACAAAATAAACAACAATGTTTAACTTCAGG
GTCCACTTCCACAACTACTCTCAGCAACACATTTAGTGATGAAACAAAGT
TGGATTGTTTTGACTTCAATATTGATAAGACTATTATGGAGATGAAAACA
ATTGATCATAGTGACAAAATCAATGAAACCTTTACCCAAAAACGTTCTTC
ATCTTTTCAAGTTCAAATTCCATCTTTTGACAGCCCCCCAAATTCACCTA
CTACTAGTTCCCAACAATACCCTACCTTAAATTCAATACAAAATGAAAGA
GTTTCCGTGTCTCCAACCGAATTGGAAAATAAGAATCATTCAACAAAAAC
CTCAAAAACCTCAAAAACCAAAAGGTCTCGTGCTAATAATGGTGAGGATC
ATATCATGGCAGAGAGAAAGCGAAGAGAGAAACTCACCCAAAGCTTCATT
GCTCTTGCAGCTCTTGTTCCCAACCTTAAAAAGATGGACAAATTTTCTGT
ATTGGTTGACACTATCAAATACATGAAAGAGCTTAAAAAGCGTTTGGAAG
TTTTAGAAGAACAAAACAAGAGAACAAAAACAGAGTCGCATGTGGTTCTG
ACCAAACCAGACCTCTGCAGCGAAGATGATTCCTCATCATTTGATGAGCG
CAATGAAAGTGTTGTTGGTTCAATATTTCAAGTGGAAGCAAAAGTGTTAG
GGAAATATATGTTGATTCGGATCCAATGTAAAGAATACAAGGGGCTTTTA
GTGAAAATTATGGTCGAGATCCAAAGATTTCAACTATATGTTGTCAACAG
CAGTGTTTTACCCTTTGGAGATTCTATCATCGATATTACTATCATTGCTC
AGTTGGGTGAAGGCTACAACTTGAGCATAAAGCAACTTGTGAAGAACATA
CGCAAGGAAGCATTGAAGTTTATGTCATTATAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR001092Helix-loop-helix DNA-binding domain
IPR011598Helix-loop-helix DNA-binding
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0030528transcription regulator activity
GO:0001071nucleic acid binding transcription factor activity
GO:0003674molecular_function
GO:0003700sequence-specific DNA binding transcription factor activity
Vocabulary: Cellular Component
TermDefinition
GO:0005634nucleus
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0008152metabolic process
GO:0008150biological_process
GO:0009812flavonoid metabolic process
GO:0071704organic substance metabolic process