Overview
NameMedtr0011s0100.1
Unique NameMedtr0011s0100.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length708
Homology
BLAST of Medtr0011s0100.1 vs. NCBI nr
Match: gi|502173665|ref|XP_004515382.1| (PREDICTED: uncharacterized protein LOC101499978 [Cicer arietinum])
BLAST of Medtr0011s0100.1 vs. NCBI nr
Match: gi|502179676|ref|XP_004516475.1| (PREDICTED: uncharacterized protein LOC101505771 [Cicer arietinum])
BLAST of Medtr0011s0100.1 vs. NCBI nr
Match: gi|356545267|ref|XP_003541066.1| (PREDICTED: uncharacterized protein LOC100797822 [Glycine max])
BLAST of Medtr0011s0100.1 vs. NCBI nr
Match: gi|356498196|ref|XP_003517939.1| (PREDICTED: uncharacterized protein LOC100802861 [Glycine max])
BLAST of Medtr0011s0100.1 vs. NCBI nr
Match: gi|356566201|ref|XP_003551323.1| (PREDICTED: uncharacterized protein LOC100809647 [Glycine max])
BLAST of Medtr0011s0100.1 vs. NCBI nr
Match: gi|502122043|ref|XP_004497551.1| (PREDICTED: uncharacterized protein LOC101490921 [Cicer arietinum])
BLAST of Medtr0011s0100.1 vs. NCBI nr
Match: gi|502168303|ref|XP_004514357.1| (PREDICTED: uncharacterized protein LOC101492845 [Cicer arietinum])
BLAST of Medtr0011s0100.1 vs. NCBI nr
Match: gi|502101972|ref|XP_004491928.1| (PREDICTED: uncharacterized protein LOC101495843 [Cicer arietinum])
BLAST of Medtr0011s0100.1 vs. NCBI nr
Match: gi|502170375|ref|XP_004514817.1| (PREDICTED: uncharacterized protein LOC101492412 [Cicer arietinum])
BLAST of Medtr0011s0100.1 vs. NCBI nr
Match: gi|502174399|ref|XP_004515505.1| (PREDICTED: uncharacterized protein LOC101501679, partial [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0011s0100.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502173665|ref|XP_004515382.1|5.471480e-7471.60PREDICTED: uncharacterized protein LOC101499978 [C... [more]
gi|502179676|ref|XP_004516475.1|6.345330e-7365.66PREDICTED: uncharacterized protein LOC101505771 [C... [more]
gi|356545267|ref|XP_003541066.1|3.586050e-6461.21PREDICTED: uncharacterized protein LOC100797822 [G... [more]
gi|356498196|ref|XP_003517939.1|7.091000e-6461.82PREDICTED: uncharacterized protein LOC100802861 [G... [more]
gi|356566201|ref|XP_003551323.1|4.273070e-6360.00PREDICTED: uncharacterized protein LOC100809647 [G... [more]
gi|502122043|ref|XP_004497551.1|2.453600e-6157.14PREDICTED: uncharacterized protein LOC101490921 [C... [more]
gi|502168303|ref|XP_004514357.1|1.069690e-6060.13PREDICTED: uncharacterized protein LOC101492845 [C... [more]
gi|502101972|ref|XP_004491928.1|1.576060e-6060.63PREDICTED: uncharacterized protein LOC101495843 [C... [more]
gi|502170375|ref|XP_004514817.1|1.855920e-6059.38PREDICTED: uncharacterized protein LOC101492412 [C... [more]
gi|502174399|ref|XP_004515505.1|3.287300e-6055.95PREDICTED: uncharacterized protein LOC101501679, p... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0011s0100.1 ID=Medtr0011s0100.1|Name=Medtr0011s0100.1|organism=Medicago truncatula|type=mRNA|length=708bp
ATGATTCAGGAGAAGATGAAGGCGTCTCAGAGTAGACAGAAGAGTTATCA
TGATAAGAGGAGAAAGGATATTGAGTTTCAAGTTGGTGATCATGTATTTT
TGAGGGTGAATCCTGTGACCGGTGTTGGTCGTGCTTTGAAGTGTAGGAAG
TTGACTCCTCATTTTGTTGGACCATTTAATGTAATTGAGAAGGTTGGGGA
TGTAGCGTATAGGATTGCGTTACCACCGTCTTTGTCGAATCTTCATAATG
TGTTTCATGTGTCTCAGTTGAGGAAGTATGTGCATGATTTGTCTCATGGG
ATACAAGTAGATGATGTGGAAGTAAGAGATAATTTGACCGTTGAGACTTG
GCCGGTTAGGATTGAGTGTCGTGACTGGAAGCGTTTGCGTGGCAAGGAGA
TTGTTTTGGTCAAGGTGATTTGGGTTGGACAACCAGGTGAGAGTGCCACT
TGGGAAGCAGAGAGTAGGATGAAGGTTTCGTATCCGGAGTTGTTTCCTTC
AGGGGTCCAAAACCGTAACATTTTCTGCAAACCTGTGAAGGTTCACTTAG
AGGTTCACTTAAGCGACCTGATTATGATGATGTATTACTTACACCCAATG
GTTTTAACCGCCTACCTGTCTGTATGGATGGGTAGACGTTGTGCAGGAGT
AGTGCTTGGTGAGTTTGTGCTTGGTGATATCGGGAGCTTTCTCCGATATC
GGTGTTGA
back to top