Overview
NameMedtr0011s0020.1
Unique NameMedtr0011s0020.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length2079
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0071554 cell wall organization or biogenesis
biological_process GO:0009987 cellular process
biological_process GO:0071669 plant-type cell wall organization or biogenesis
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0071944 cell periphery
cellular_component GO:0005575 cellular_component
cellular_component GO:0016020 membrane
cellular_component GO:0005886 plasma membrane
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03552.912719-13675371-689366-683140.15.5e-45368.94.5e-110

Homology
BLAST of Medtr0011s0020.1 vs. NCBI nr
Match: gi|502127117|ref|XP_004499569.1| (PREDICTED: cellulose synthase-like protein G1-like [Cicer arietinum])
BLAST of Medtr0011s0020.1 vs. NCBI nr
Match: gi|356539486|ref|XP_003538229.1| (PREDICTED: cellulose synthase-like protein G2-like isoform X1 [Glycine max])
BLAST of Medtr0011s0020.1 vs. NCBI nr
Match: gi|356515422|ref|XP_003526399.1| (PREDICTED: cellulose synthase-like protein G1-like [Glycine max])
BLAST of Medtr0011s0020.1 vs. NCBI nr
Match: gi|356507696|ref|XP_003522600.1| (PREDICTED: cellulose synthase-like protein G1-like [Glycine max])
BLAST of Medtr0011s0020.1 vs. NCBI nr
Match: gi|590659056|ref|XP_007035023.1| (Cellulose synthase, putative isoform 1 [Theobroma cacao] >gi|508714052|gb|EOY05949.1| Cellulose synthase, putative isoform 1 [Theobroma cacao])
BLAST of Medtr0011s0020.1 vs. NCBI nr
Match: gi|356548660|ref|XP_003542718.1| (PREDICTED: cellulose synthase A catalytic subunit 4 [UDP-forming]-like isoform X1 [Glycine max])
BLAST of Medtr0011s0020.1 vs. NCBI nr
Match: gi|297737188|emb|CBI26389.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0011s0020.1 vs. NCBI nr
Match: gi|590659067|ref|XP_007035026.1| (Cellulose synthase like G2, putative [Theobroma cacao] >gi|508714055|gb|EOY05952.1| Cellulose synthase like G2, putative [Theobroma cacao])
BLAST of Medtr0011s0020.1 vs. NCBI nr
Match: gi|590659075|ref|XP_007035028.1| (Cellulose synthase like G2, putative isoform 1 [Theobroma cacao] >gi|508714057|gb|EOY05954.1| Cellulose synthase like G2, putative isoform 1 [Theobroma cacao])
BLAST of Medtr0011s0020.1 vs. NCBI nr
Match: gi|460396147|ref|XP_004243640.1| (PREDICTED: cellulose synthase-like protein G1-like [Solanum lycopersicum])
The following BLAST results are available for this feature:
BLAST of Medtr0011s0020.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502127117|ref|XP_004499569.1|0.000000e+072.33PREDICTED: cellulose synthase-like protein G1-like... [more]
gi|356539486|ref|XP_003538229.1|0.000000e+070.76PREDICTED: cellulose synthase-like protein G2-like... [more]
gi|356515422|ref|XP_003526399.1|0.000000e+069.57PREDICTED: cellulose synthase-like protein G1-like... [more]
gi|356507696|ref|XP_003522600.1|0.000000e+066.18PREDICTED: cellulose synthase-like protein G1-like... [more]
gi|590659056|ref|XP_007035023.1|0.000000e+052.17Cellulose synthase, putative isoform 1 [Theobroma ... [more]
gi|356548660|ref|XP_003542718.1|0.000000e+045.75PREDICTED: cellulose synthase A catalytic subunit ... [more]
gi|297737188|emb|CBI26389.3|0.000000e+045.75unnamed protein product [Vitis vinifera][more]
gi|590659067|ref|XP_007035026.1|0.000000e+044.15Cellulose synthase like G2, putative [Theobroma ca... [more]
gi|590659075|ref|XP_007035028.1|0.000000e+044.27Cellulose synthase like G2, putative isoform 1 [Th... [more]
gi|460396147|ref|XP_004243640.1|0.000000e+046.41PREDICTED: cellulose synthase-like protein G1-like... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableCOILcoilcoiled-coilcoord: 112..133
score
NoneNo IPR availableSUPERFAMILY53448Nucleotide-diphospho-sugar transferasescoord: 8..279
score: 4.1

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0011s0020.1 ID=Medtr0011s0020.1|Name=Medtr0011s0020.1|organism=Medicago truncatula|type=mRNA|length=2079bp
ATGGCAACCTTCACACTTCACAAAGAAACAGTTCAACCATGGTTACCTCT
AAGAAGAGCTTACATAATCTTCCACTTCACATGTGTCTTGTTTCTCTTTT
ACTACCGTATCAGCAATTTGTTTATTTCATATCCATGGTTTCTAATGACA
ATAGCTGAGATTATTCTATCATTTTTGTGGTTTTTCAACCAAGCATTCCG
TTGGAGGCTGGTAAATCGTTCAGTTATGACCGAGAAATTACCGCCCGACG
AGAAGTTACCGGGACTCGACATATTTGTGTGTACGATTGATCCTGAAAAA
GAACCAACGGTTGATGTTATGAACACTGTTATTTCTGCTATTGCAATGGA
CTACCCTTCTAATAAACTTTCTATTTATCTTTCTGATGATGGAGGTTCCC
CTATTACTCTTTTTGGGATTAAAGAGGCTTTTGAATTTGCTAAAGTTTGG
GTTCCTTTTTGTAAAAAATATGATGTTAAGTCAAGGTGTCCTAAGTTTTT
CTTCTCTGCTTTGGGTGAGAATGAACGACTACATCGACCTCGTGAATTTG
AAGAAGAGAGGGACCAGATTAAGGCCAAATACGAGAAAATGCAAAAAAAT
ATTGACAAATTCGGAAGCAACCTAAAGAATCTTTGTATGGTGACTGATAG
ACCTTCTCGGATCGAGATCATTAATGACCAAAAAGAAATGCCACTAGTTG
TTTATGTGTCTCGTGAAAAAAGACCAAATGTTCCTCACAGATTCAAAGGA
GGAGCTCTCAATACATTGCTTAGGGTGTCAGGGCTAATCAGCAATGGACC
TTATGTTCTTGTGGTAGATTGTGATATGAATTGTAATGATGCATCATCAG
CCAAACAATCTATGTGCTTTTTTCTTGATCCTGAAACCTCTAAAGATGTT
GCTTTTGTTCAATTCCCTCAAATGTTTCACAACCTTAGCAAGAAAGACAT
ATATGATAGTCAGACTAGGACTGCTTTTACGACAAAGTGGAAAGGAATGG
ATGGATTAAGAGGTCCAGGTCTAACTGGCAGTGGAAATTATATAAGTAGA
AGTGCATTACTCTTTGGAAGTCCAAACCAAAAAGGGGACTATCTACTTGA
TGCTCTATACAACTTTGGCAAGTCAAATATGTATGTAGAATCACTTAAAG
CATTACGTGGTCAACAAACTAATAAGCAGAATGTTTCAAGAGACGTAATT
TTACAAGAAGCATGTGAAGTGGCTTCTTGTTCCTATGAGAGAAACACAAA
TTGGGGTAATGAGGTGGGATTCTCGTATGCTATAAAACTTGAGAGTACTG
TTACTGGCTATCTCCTCCATTGCAGAGGATGGAGATCAACTTATCTTTAC
CCAAAAAGGCCATGTTTCTTAGGATGTGCTCCAACTGATATGAAAGAGGG
ATTAATTCAACCCATAAAATGGTCATCTGAACTTTTGTTACTTGCAATCT
CTAAATATAGTCCATTCACTTATGGCCTTTCAAGATTGCCTACTATTCAT
TGTTTAACTTTTTGTTACTTAGTAAGCACAACCCAATTTGCAACAGCCTA
TATCCTATATGGATTCGTTCCTCAGATTTGCTTCTTGAAGGGAATACCTG
TATATCCAAAGGTTACAGATCCTTGGTTTATAGTGTTTACAGTGTTGTAT
CTATCCAGTCAAATTCATCATTACATTGAGGTAATTTCAACTGGTGGCAC
CTCGATGATTTGGTGGAATGAACAAAGAAGTGGGATTGTAAAATCAATTG
GGTGCGTTTTCGCAATTATAGAAACAACGAAAAAAAAGTTTGGGTTGAAC
AAGGCAAACTTCACTTTATCAGACAAAGCAATTGACAAAGATAAGCTAAA
GAAATATGAGCAGGGTAAGTTTAATTTTGATGGTGCAGCATTGCTTATGG
CACCAGTTATTGTGTTACTCACAATAAATATTGTTTGCTTCTTTGGTGGT
TTATGGAGACTACTCATTGTGAAGAATTTTGATGAAATGTTTGGTCAACT
TTTCCTCATTATCTATATACTTTCTCTAAGTCGTCCTATTGTGGAGGGGA
TTATATCTATGAAGCGGAAGAGTGGGTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated
Vocabulary: Cellular Component
TermDefinition
GO:0005886plasma membrane
GO:0005575cellular_component
GO:0016020membrane
GO:0005623cell
GO:0044464cell part
GO:0071944cell periphery
Vocabulary: Biological Process
TermDefinition
GO:0008150biological_process
GO:0009987cellular process
GO:0071554cell wall organization or biogenesis
GO:0071669plant-type cell wall organization or biogenesis