Overview
NameMedtr0010s0400.1
Unique NameMedtr0010s0400.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1383
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03141.11253121-252807304-408109-21526.51.2e-1027.01.2e-06

Homology
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|15229977|ref|NP_187190.1| (uncharacterized protein [Arabidopsis thaliana] >gi|7596772|gb|AAF64543.1| hypothetical protein [Arabidopsis thaliana] >gi|50058925|gb|AAT69207.1| hypothetical protein At3g05390 [Arabidopsis thaliana] >gi|332640711|gb|AEE74232.1| uncharacterized protein AT3G05390 [Arabidopsis thaliana])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|565483110|ref|XP_006299195.1| (hypothetical protein CARUB_v10015342mg [Capsella rubella] >gi|482567904|gb|EOA32093.1| hypothetical protein CARUB_v10015342mg [Capsella rubella])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|49660139|gb|AAT68360.1| (hypothetical protein At3g05390 [Arabidopsis thaliana])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|296089662|emb|CBI39481.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|460377324|ref|XP_004234443.1| (PREDICTED: uncharacterized protein LOC101265707 [Solanum lycopersicum])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|224123116|ref|XP_002318999.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|326532372|dbj|BAK05115.1| (predicted protein [Hordeum vulgare subsp. vulgare])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|357124335|ref|XP_003563856.1| (PREDICTED: uncharacterized protein LOC100824970 [Brachypodium distachyon])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|413941595|gb|AFW74244.1| (hypothetical protein ZEAMMB73_912598 [Zea mays])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|242080219|ref|XP_002444878.1| (hypothetical protein SORBIDRAFT_07g000800 [Sorghum bicolor] >gi|241941228|gb|EES14373.1| hypothetical protein SORBIDRAFT_07g000800 [Sorghum bicolor])
The following BLAST results are available for this feature:
BLAST of Medtr0010s0400.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|15229977|ref|NP_187190.1|0.000000e+073.22uncharacterized protein [Arabidopsis thaliana] >gi... [more]
gi|565483110|ref|XP_006299195.1|0.000000e+073.22hypothetical protein CARUB_v10015342mg [Capsella r... [more]
gi|49660139|gb|AAT68360.1|0.000000e+072.79hypothetical protein At3g05390 [Arabidopsis thalia... [more]
gi|296089662|emb|CBI39481.3|0.000000e+071.06unnamed protein product [Vitis vinifera][more]
gi|460377324|ref|XP_004234443.1|0.000000e+067.60PREDICTED: uncharacterized protein LOC101265707 [S... [more]
gi|224123116|ref|XP_002318999.1|0.000000e+086.90predicted protein [Populus trichocarpa][more]
gi|326532372|dbj|BAK05115.1|0.000000e+056.28predicted protein [Hordeum vulgare subsp. vulgare][more]
gi|357124335|ref|XP_003563856.1|0.000000e+055.79PREDICTED: uncharacterized protein LOC100824970 [B... [more]
gi|413941595|gb|AFW74244.1|0.000000e+053.61hypothetical protein ZEAMMB73_912598 [Zea mays][more]
gi|242080219|ref|XP_002444878.1|0.000000e+053.56hypothetical protein SORBIDRAFT_07g000800 [Sorghum... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableCOILcoilcoiled-coilcoord: 79..100
score
NoneNo IPR availableGENE3D3.40.50.150no descriptioncoord: 290..441
score: 0.0
NoneNo IPR availableSEGsegsegcoord: 20..34
score: NAcoord: 383..399
score
NoneNo IPR availableSUPERFAMILY53335S-adenosyl-L-methionine-dependent methyltransferasescoord: 264..410
score: 4.6

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0010s0400.1 ID=Medtr0010s0400.1|Name=Medtr0010s0400.1|organism=Medicago truncatula|type=mRNA|length=1383bp
ATGGGGAGGTCATGTCTTCGCAAATGCAAACCTGCAAGAGTAATGGGTTG
GTTACAAATCATTTTGGGAGGGTTAGTAATCTTAGTAAGTATATTAAGCC
TAACAAGATTCTACTATGCTGGTTTTTTCTTTCACAATGAAGAAATATGC
CAACATTTCTTTACTATAAGAGATCTAAATGATGGTTTTGATGCCAAAGC
ATTATCTGATAGAGTTGGAGAAGTATTGGATATGTTGGAATCTTTGCAGG
GAAAGCTTGAGTTAAAAGAACAAGAAATGGAGAAAAACAAGAGCATAACC
TTAGATAAGAAATATTTAGAGGATGAAATAGTTAGGCCTCTTCATAGTGC
TAATGTTGCTTTAAGACAGATTAGACTTCCAAAGTTTGAAGAAAGAGGAA
ACTCCACAGTAAAAGAGGATCCTTTGATTAATTTTTTTGTCACTGAGGAG
ATTAGAAAGTATATAACCCCAAAGGAGAATAGAGTTAGTAGGATTAATCT
ATATGGGTCAGACAAGGTTTATAACACAATTGGGCATGCATGTGTTTTGC
ATAAGAAAGAGCTAGAACAGTACATGGACTATGACATTGGTTCATACTGT
GATGATGATTGGAATTTAGCTCAAAAGCTTATGCTTAATGGGTGTGATCC
TTTACCTAGAAGAAGATGTTTGACACGGGCTTCGAAAGTTTACAGTAAAC
CTTACCCAATCAATGAGTCACTCTGGAGATTACCAGATGAAAGAAATGTT
AGATGGGGGAATTACCAATGTAGAAATTTTGAGTGCTTATCAAGCAAGAA
TCCAAAGAAGGGCTATTCAAAATGTACTGGATGTTTTGAAATGGAAAAGG
AAAAGCTGAAATGGGTTACTAATAGCTCACTTTCTGCAGATTTTTTGATC
AGTGATGTTTTGGCAATTAAGACTGGAGAGATAAGGATTGGACTAGACTA
CGGAATCGGCACCGGCACGTTTGCTGCAAGGATGAGGGAAAAGAATGTAA
CAATTGTTTCAACAGCTTTGAACCTTGGTGCTCCTTTCAATGAGATGATA
GCTCTAAGGGGTTTGGTTCCTTTATATGTTACATTAAATCAAAGGCTTCC
ATTCTTTGATAACATTATGGATTTGATTCATACAACTGGGTTTATGGATG
GTTGGATTGATCTGCTATTATTGGATTTCATATTGTATGATTGGGATAGA
ATTTTAAGACCAGGAGGGTTACTATGGATTGATAGGTTCTTTTGTAAAAG
AAAGGATTTAGATGATTATATGTACATGTTTCTTCAACTAAGGTACAAGA
AACACAAGTGGGTTATTTCTCCAAAGTCAAAGGATGAAATATATCTCTCT
GCGTTGCTCGAAAAACCTCCAAGAGCCATATGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated