Overview
NameMedtr0010s0400.1
Unique NameMedtr0010s0400.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1383
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03141.11253121-252807304-408109-21526.51.2e-1027.01.2e-06

Homology
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|502094772|ref|XP_004490294.1| (PREDICTED: uncharacterized protein LOC101497349 [Cicer arietinum])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|356499988|ref|XP_003518817.1| (PREDICTED: uncharacterized protein LOC100782372 [Glycine max])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|590643999|ref|XP_007030960.1| (Methyltransferase, putative [Theobroma cacao] >gi|508719565|gb|EOY11462.1| Methyltransferase, putative [Theobroma cacao])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|147840232|emb|CAN77378.1| (hypothetical protein VITISV_043863 [Vitis vinifera])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|225450861|ref|XP_002284169.1| (PREDICTED: uncharacterized protein LOC100257940 [Vitis vinifera])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|595823908|ref|XP_007205147.1| (hypothetical protein PRUPE_ppa005305mg [Prunus persica] >gi|462400789|gb|EMJ06346.1| hypothetical protein PRUPE_ppa005305mg [Prunus persica])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|460368726|ref|XP_004230216.1| (PREDICTED: uncharacterized protein LOC101247261 [Solanum lycopersicum])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|470133100|ref|XP_004302412.1| (PREDICTED: uncharacterized protein LOC101291062 [Fragaria vesca subsp. vesca])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|449435669|ref|XP_004135617.1| (PREDICTED: uncharacterized protein LOC101207467 [Cucumis sativus] >gi|449485703|ref|XP_004157250.1| PREDICTED: uncharacterized LOC101207467 [Cucumis sativus])
BLAST of Medtr0010s0400.1 vs. NCBI nr
Match: gi|297833256|ref|XP_002884510.1| (hypothetical protein ARALYDRAFT_477828 [Arabidopsis lyrata subsp. lyrata] >gi|297330350|gb|EFH60769.1| hypothetical protein ARALYDRAFT_477828 [Arabidopsis lyrata subsp. lyrata])
The following BLAST results are available for this feature:
BLAST of Medtr0010s0400.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502094772|ref|XP_004490294.1|0.000000e+088.72PREDICTED: uncharacterized protein LOC101497349 [C... [more]
gi|356499988|ref|XP_003518817.1|0.000000e+086.39PREDICTED: uncharacterized protein LOC100782372 [G... [more]
gi|590643999|ref|XP_007030960.1|0.000000e+076.81Methyltransferase, putative [Theobroma cacao] >gi|... [more]
gi|147840232|emb|CAN77378.1|0.000000e+076.67hypothetical protein VITISV_043863 [Vitis vinifera... [more]
gi|225450861|ref|XP_002284169.1|0.000000e+076.67PREDICTED: uncharacterized protein LOC100257940 [V... [more]
gi|595823908|ref|XP_007205147.1|0.000000e+077.14hypothetical protein PRUPE_ppa005305mg [Prunus per... [more]
gi|460368726|ref|XP_004230216.1|0.000000e+073.40PREDICTED: uncharacterized protein LOC101247261 [S... [more]
gi|470133100|ref|XP_004302412.1|0.000000e+076.12PREDICTED: uncharacterized protein LOC101291062 [F... [more]
gi|449435669|ref|XP_004135617.1|0.000000e+072.52PREDICTED: uncharacterized protein LOC101207467 [C... [more]
gi|297833256|ref|XP_002884510.1|0.000000e+073.22hypothetical protein ARALYDRAFT_477828 [Arabidopsi... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableCOILcoilcoiled-coilcoord: 79..100
score
NoneNo IPR availableGENE3D3.40.50.150no descriptioncoord: 290..441
score: 0.0
NoneNo IPR availableSEGsegsegcoord: 20..34
score: NAcoord: 383..399
score
NoneNo IPR availableSUPERFAMILY53335S-adenosyl-L-methionine-dependent methyltransferasescoord: 264..410
score: 4.6

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0010s0400.1 ID=Medtr0010s0400.1|Name=Medtr0010s0400.1|organism=Medicago truncatula|type=mRNA|length=1383bp
ATGGGGAGGTCATGTCTTCGCAAATGCAAACCTGCAAGAGTAATGGGTTG
GTTACAAATCATTTTGGGAGGGTTAGTAATCTTAGTAAGTATATTAAGCC
TAACAAGATTCTACTATGCTGGTTTTTTCTTTCACAATGAAGAAATATGC
CAACATTTCTTTACTATAAGAGATCTAAATGATGGTTTTGATGCCAAAGC
ATTATCTGATAGAGTTGGAGAAGTATTGGATATGTTGGAATCTTTGCAGG
GAAAGCTTGAGTTAAAAGAACAAGAAATGGAGAAAAACAAGAGCATAACC
TTAGATAAGAAATATTTAGAGGATGAAATAGTTAGGCCTCTTCATAGTGC
TAATGTTGCTTTAAGACAGATTAGACTTCCAAAGTTTGAAGAAAGAGGAA
ACTCCACAGTAAAAGAGGATCCTTTGATTAATTTTTTTGTCACTGAGGAG
ATTAGAAAGTATATAACCCCAAAGGAGAATAGAGTTAGTAGGATTAATCT
ATATGGGTCAGACAAGGTTTATAACACAATTGGGCATGCATGTGTTTTGC
ATAAGAAAGAGCTAGAACAGTACATGGACTATGACATTGGTTCATACTGT
GATGATGATTGGAATTTAGCTCAAAAGCTTATGCTTAATGGGTGTGATCC
TTTACCTAGAAGAAGATGTTTGACACGGGCTTCGAAAGTTTACAGTAAAC
CTTACCCAATCAATGAGTCACTCTGGAGATTACCAGATGAAAGAAATGTT
AGATGGGGGAATTACCAATGTAGAAATTTTGAGTGCTTATCAAGCAAGAA
TCCAAAGAAGGGCTATTCAAAATGTACTGGATGTTTTGAAATGGAAAAGG
AAAAGCTGAAATGGGTTACTAATAGCTCACTTTCTGCAGATTTTTTGATC
AGTGATGTTTTGGCAATTAAGACTGGAGAGATAAGGATTGGACTAGACTA
CGGAATCGGCACCGGCACGTTTGCTGCAAGGATGAGGGAAAAGAATGTAA
CAATTGTTTCAACAGCTTTGAACCTTGGTGCTCCTTTCAATGAGATGATA
GCTCTAAGGGGTTTGGTTCCTTTATATGTTACATTAAATCAAAGGCTTCC
ATTCTTTGATAACATTATGGATTTGATTCATACAACTGGGTTTATGGATG
GTTGGATTGATCTGCTATTATTGGATTTCATATTGTATGATTGGGATAGA
ATTTTAAGACCAGGAGGGTTACTATGGATTGATAGGTTCTTTTGTAAAAG
AAAGGATTTAGATGATTATATGTACATGTTTCTTCAACTAAGGTACAAGA
AACACAAGTGGGTTATTTCTCCAAAGTCAAAGGATGAAATATATCTCTCT
GCGTTGCTCGAAAAACCTCCAAGAGCCATATGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated