Overview
NameMedtr0010s0390.1
Unique NameMedtr0010s0390.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length339
Homology
BLAST of Medtr0010s0390.1 vs. NCBI nr
Match: gi|502161900|ref|XP_004512322.1| (PREDICTED: zinc finger MYM-type protein 1-like isoform X3 [Cicer arietinum])
BLAST of Medtr0010s0390.1 vs. NCBI nr
Match: gi|502161897|ref|XP_004512321.1| (PREDICTED: zinc finger MYM-type protein 1-like isoform X2 [Cicer arietinum])
BLAST of Medtr0010s0390.1 vs. NCBI nr
Match: gi|502161894|ref|XP_004512320.1| (PREDICTED: zinc finger MYM-type protein 1-like isoform X1 [Cicer arietinum])
BLAST of Medtr0010s0390.1 vs. NCBI nr
Match: gi|470113389|ref|XP_004292906.1| (PREDICTED: uncharacterized protein LOC101296462 [Fragaria vesca subsp. vesca])
BLAST of Medtr0010s0390.1 vs. NCBI nr
Match: gi|470145344|ref|XP_004308301.1| (PREDICTED: zinc finger MYM-type protein 1-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0010s0390.1 vs. NCBI nr
Match: gi|470119769|ref|XP_004295983.1| (PREDICTED: uncharacterized protein LOC101313497 [Fragaria vesca subsp. vesca])
BLAST of Medtr0010s0390.1 vs. NCBI nr
Match: gi|470113733|ref|XP_004293075.1| (PREDICTED: zinc finger MYM-type protein 1-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0010s0390.1 vs. NCBI nr
Match: gi|470124117|ref|XP_004298063.1| (PREDICTED: uncharacterized protein LOC101294259 [Fragaria vesca subsp. vesca])
BLAST of Medtr0010s0390.1 vs. NCBI nr
Match: gi|356565937|ref|XP_003551192.1| (PREDICTED: uncharacterized protein LOC100784329 [Glycine max])
BLAST of Medtr0010s0390.1 vs. NCBI nr
Match: gi|224106123|ref|XP_002333722.1| (predicted protein [Populus trichocarpa])
The following BLAST results are available for this feature:
BLAST of Medtr0010s0390.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502161900|ref|XP_004512322.1|1.525060e-1776.92PREDICTED: zinc finger MYM-type protein 1-like iso... [more]
gi|502161897|ref|XP_004512321.1|1.854180e-1776.92PREDICTED: zinc finger MYM-type protein 1-like iso... [more]
gi|502161894|ref|XP_004512320.1|2.005370e-1776.92PREDICTED: zinc finger MYM-type protein 1-like iso... [more]
gi|470113389|ref|XP_004292906.1|3.349080e-1558.62PREDICTED: uncharacterized protein LOC101296462 [F... [more]
gi|470145344|ref|XP_004308301.1|2.476050e-1459.32PREDICTED: zinc finger MYM-type protein 1-like [Fr... [more]
gi|470119769|ref|XP_004295983.1|4.867570e-1454.24PREDICTED: uncharacterized protein LOC101313497 [F... [more]
gi|470113733|ref|XP_004293075.1|9.111020e-1459.32PREDICTED: zinc finger MYM-type protein 1-like [Fr... [more]
gi|470124117|ref|XP_004298063.1|2.987350e-1360.00PREDICTED: uncharacterized protein LOC101294259 [F... [more]
gi|356565937|ref|XP_003551192.1|6.828800e-1379.07PREDICTED: uncharacterized protein LOC100784329 [G... [more]
gi|224106123|ref|XP_002333722.1|1.244480e-1255.93predicted protein [Populus trichocarpa][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 17..41
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0010s0390.1 ID=Medtr0010s0390.1|Name=Medtr0010s0390.1|organism=Medicago truncatula|type=mRNA|length=339bp
ATGGTACTCGTTCAGATTCGTGGTACGCGACATGAGAAGAATTCGAAAAC
CCTTCTTCCTCCACTACCACCACTCTCATCCACTCTGGCGGCCGAACCAC
CACCAAGCTCCGCCACGCCACCACACATCCCATTCCATCTTCACTTTTGC
GACCTATCCACCATCAAGCTCATGAATAATTTTGATTTTGCACTCACATT
GCATTTGATGAAAAAGGTCTTAAGTATTTCGAATGAATTGTCACAAGCAT
TGCAAAGGAAAGATCAAGATATCATCAATGTTATGAACCTGGTTAACATC
ACAAAGGAGCGATTACAAGCTCTAAGAGATGATGGATAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated