Overview
NameMedtr0010s0370.1
Unique NameMedtr0010s0370.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length567
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF14111.1249475-24906230-16715-152108.21.3e-35108.41.5e-31

Homology
BLAST of Medtr0010s0370.1 vs. NCBI nr
Match: gi|224097606|ref|XP_002311007.1| (hypothetical protein POPTR_0008s02040g [Populus trichocarpa] >gi|222850827|gb|EEE88374.1| hypothetical protein POPTR_0008s02040g [Populus trichocarpa])
BLAST of Medtr0010s0370.1 vs. NCBI nr
Match: gi|147805050|emb|CAN71439.1| (hypothetical protein VITISV_011331 [Vitis vinifera])
BLAST of Medtr0010s0370.1 vs. NCBI nr
Match: gi|147823314|emb|CAN77450.1| (hypothetical protein VITISV_016971 [Vitis vinifera])
BLAST of Medtr0010s0370.1 vs. NCBI nr
Match: gi|359495673|ref|XP_003635054.1| (PREDICTED: cysteine desulfurase 1, mitochondrial [Vitis vinifera])
BLAST of Medtr0010s0370.1 vs. NCBI nr
Match: gi|147827385|emb|CAN68617.1| (hypothetical protein VITISV_000452 [Vitis vinifera])
BLAST of Medtr0010s0370.1 vs. NCBI nr
Match: gi|470114753|ref|XP_004293574.1| (PREDICTED: uncharacterized protein LOC101304253 [Fragaria vesca subsp. vesca])
BLAST of Medtr0010s0370.1 vs. NCBI nr
Match: gi|255559276|ref|XP_002520658.1| (conserved hypothetical protein [Ricinus communis] >gi|223540043|gb|EEF41620.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0010s0370.1 vs. NCBI nr
Match: gi|255575177|ref|XP_002528493.1| (conserved hypothetical protein [Ricinus communis] >gi|223532102|gb|EEF33910.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0010s0370.1 vs. NCBI nr
Match: gi|332322135|emb|CCA66043.1| (hypothetical protein [Beta vulgaris subsp. vulgaris])
BLAST of Medtr0010s0370.1 vs. NCBI nr
Match: gi|255584690|ref|XP_002533066.1| (conserved hypothetical protein [Ricinus communis] >gi|223527130|gb|EEF29305.1| conserved hypothetical protein [Ricinus communis])
The following BLAST results are available for this feature:
BLAST of Medtr0010s0370.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|224097606|ref|XP_002311007.1|8.532560e-3839.53hypothetical protein POPTR_0008s02040g [Populus tr... [more]
gi|147805050|emb|CAN71439.1|2.400120e-3541.71hypothetical protein VITISV_011331 [Vitis vinifera... [more]
gi|147823314|emb|CAN77450.1|3.749550e-3547.41hypothetical protein VITISV_016971 [Vitis vinifera... [more]
gi|359495673|ref|XP_003635054.1|4.562420e-3542.29PREDICTED: cysteine desulfurase 1, mitochondrial [... [more]
gi|147827385|emb|CAN68617.1|1.101750e-3339.43hypothetical protein VITISV_000452 [Vitis vinifera... [more]
gi|470114753|ref|XP_004293574.1|1.209910e-3039.33PREDICTED: uncharacterized protein LOC101304253 [F... [more]
gi|255559276|ref|XP_002520658.1|8.743840e-2935.75conserved hypothetical protein [Ricinus communis] ... [more]
gi|255575177|ref|XP_002528493.1|1.428340e-2837.82conserved hypothetical protein [Ricinus communis] ... [more]
gi|332322135|emb|CCA66043.1|5.844570e-2735.39hypothetical protein [Beta vulgaris subsp. vulgari... [more]
gi|255584690|ref|XP_002533066.1|1.799370e-2537.11conserved hypothetical protein [Ricinus communis] ... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 7..18
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0010s0370.1 ID=Medtr0010s0370.1|Name=Medtr0010s0370.1|organism=Medicago truncatula|type=mRNA|length=567bp
ATGGCTTCTCTCCATCAACTCTCCTTGAGTAATGAAGAGGTTGAACTTGA
GTTGCATCCAGTCATTACTCTCACACAACCATCTAATCTTAATCTCCTCC
TTGTGGGTCGATTCTTAACCAATAGGCCTATTCGTTCTTACATGATGATG
GAGAAGATTAAAACCTTTTGGAACCCAGTTCGTGAAATGAGAATAGAGGA
GATTGAACCAGGCCTCTATTCATTCCAATTCACCCACCATCTCGACATGC
AAAGAATTCTCAAGAAAGGCCCTTGGTACTTTGACAACCATCTCTTGATG
CTCAATGTTGTGCCAGCCAATGGAAATCCGAATCAGGTTGCTTTACAATT
TGTCCCTTTTTGGATTCAGGTACATGATCTTCCAACTGGTTTTATGTCTG
AAAAAGTCGGAAAAGATATCGCTAATCACATTGGTGAGTTTCTTGAGTAT
GATGCTAAAAACAATTCCAACTTCCTCCATACATATATGAGAATTCGTGT
TTTACTTGATGTCACAAAGCCTCTGAAACGCCTGAAAAAAAATCAGAAAA
CCAGGAGGGGAGTCTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated