Overview
NameMedtr0010s0220.1
Unique NameMedtr0010s0220.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length3078
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0065007 biological regulation
biological_process GO:0008150 biological_process
biological_process GO:0007154 cell communication
biological_process GO:0009987 cellular process
biological_process GO:0051716 cellular response to stimulus
biological_process GO:0006886 intracellular protein transport
biological_process GO:0050789 regulation of biological process
biological_process GO:0050794 regulation of cellular process
biological_process GO:0050896 response to stimulus
biological_process GO:0007165 signal transduction
biological_process GO:0023052 signaling
biological_process GO:0044700 single organism signaling
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0005622 intracellular
cellular_component GO:0044424 intracellular part
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
molecular_function GO:0008565 protein transporter activity
molecular_function GO:0022892 substrate-specific transporter activity
molecular_function GO:0005215 transporter activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03810.14167151-16692430-1051-7656.16.5e-1958.63.9e-16

Homology
BLAST of Medtr0010s0220.1 vs. NCBI nr
Match: gi|502094768|ref|XP_004490293.1| (PREDICTED: importin-9-like [Cicer arietinum])
BLAST of Medtr0010s0220.1 vs. NCBI nr
Match: gi|356496034|ref|XP_003516875.1| (PREDICTED: importin-9-like [Glycine max])
BLAST of Medtr0010s0220.1 vs. NCBI nr
Match: gi|356502694|ref|XP_003520152.1| (PREDICTED: importin-9-like [Glycine max])
BLAST of Medtr0010s0220.1 vs. NCBI nr
Match: gi|297737920|emb|CBI27121.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0010s0220.1 vs. NCBI nr
Match: gi|225423792|ref|XP_002277492.1| (PREDICTED: importin-9-like [Vitis vinifera])
BLAST of Medtr0010s0220.1 vs. NCBI nr
Match: gi|470124647|ref|XP_004298322.1| (PREDICTED: importin-9-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0010s0220.1 vs. NCBI nr
Match: gi|590698207|ref|XP_007045654.1| (ARM repeat superfamily protein isoform 1 [Theobroma cacao] >gi|508709589|gb|EOY01486.1| ARM repeat superfamily protein isoform 1 [Theobroma cacao])
BLAST of Medtr0010s0220.1 vs. NCBI nr
Match: gi|590698211|ref|XP_007045655.1| (ARM repeat superfamily protein isoform 2 [Theobroma cacao] >gi|508709590|gb|EOY01487.1| ARM repeat superfamily protein isoform 2 [Theobroma cacao])
BLAST of Medtr0010s0220.1 vs. NCBI nr
Match: gi|596295807|ref|XP_007227066.1| (hypothetical protein PRUPE_ppa000608mg [Prunus persica] >gi|462424002|gb|EMJ28265.1| hypothetical protein PRUPE_ppa000608mg [Prunus persica])
BLAST of Medtr0010s0220.1 vs. NCBI nr
Match: gi|590698218|ref|XP_007045657.1| (ARM repeat superfamily protein isoform 4 [Theobroma cacao] >gi|508709592|gb|EOY01489.1| ARM repeat superfamily protein isoform 4 [Theobroma cacao])
The following BLAST results are available for this feature:
BLAST of Medtr0010s0220.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502094768|ref|XP_004490293.1|0.000000e+088.11PREDICTED: importin-9-like [Cicer arietinum][more]
gi|356496034|ref|XP_003516875.1|0.000000e+083.92PREDICTED: importin-9-like [Glycine max][more]
gi|356502694|ref|XP_003520152.1|0.000000e+080.80PREDICTED: importin-9-like [Glycine max][more]
gi|297737920|emb|CBI27121.3|0.000000e+073.07unnamed protein product [Vitis vinifera][more]
gi|225423792|ref|XP_002277492.1|0.000000e+071.16PREDICTED: importin-9-like [Vitis vinifera][more]
gi|470124647|ref|XP_004298322.1|0.000000e+070.52PREDICTED: importin-9-like [Fragaria vesca subsp. ... [more]
gi|590698207|ref|XP_007045654.1|0.000000e+070.69ARM repeat superfamily protein isoform 1 [Theobrom... [more]
gi|590698211|ref|XP_007045655.1|0.000000e+070.38ARM repeat superfamily protein isoform 2 [Theobrom... [more]
gi|596295807|ref|XP_007227066.1|0.000000e+067.98hypothetical protein PRUPE_ppa000608mg [Prunus per... [more]
gi|590698218|ref|XP_007045657.1|0.000000e+068.43ARM repeat superfamily protein isoform 4 [Theobrom... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001494Importin-beta, N-terminalSMARTSM00913no descriptioncoord: 30..103
score: 4.6
IPR001494Importin-beta, N-terminalPROFILEPS50166IMPORTIN_B_NTcoord: 30..103
score: 13
IPR011989Armadillo-like helicalGENE3D1.25.10.10no descriptioncoord: 6..907
score: 2.1
IPR016024Armadillo-type foldSUPERFAMILY48371ARM repeatcoord: 1..1022
score: 4.1e
NoneNo IPR availableSEGsegsegcoord: 125..138
score: NAcoord: 440..455
score: NAcoord: 844..854
score: NAcoord: 961..969
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0010s0220.1 ID=Medtr0010s0220.1|Name=Medtr0010s0220.1|organism=Medicago truncatula|type=mRNA|length=3078bp
ATGGCCTACGTTGTAGATCAAGATCAACAATGGCTTCTCAGTTGCTTATC
TGCCACACTCGATCCTAACCACGAGATTCGTTCTTTTGCCGAAGCTTCTC
TTCATCAAGCCTCTCACCAATCAGGTTTTGGCACTGCATTATCAAAAGTC
ATTGCAAACAAGGACATTGCTGTGGGATTGCGCCAGTTAGCTGCAGTCCT
TCTTAAGCAATTAGTTAAAAAACATTGGCAGGAGGGTGAAGAATCATTTG
AACCTCCTGTGGTTTCCGCTGATGAAAAGGAAATCATCCGCAGAATGCTT
CTATTGACATTAGACGACCCTCATCGGAAAATTTGCACAGCTATTGGTAT
GGCCGTGGCATCCATTGCAGTGTATGACTGGCCAGAGTTATGGCCAGATT
TATTGCCATTTCTCCTGAATTTGATCAACAGTCAAACCAACTTGAATGGA
GTGCATGGAGCTATGAAATGCTTGGTTCTTCTCTCAGCGGACTTGGATGA
TAGAACGGTTCCAACATTAATACCTGCTTTGTTCCCAAGTTTGCTGACCA
TTGTATCCTCTCCGCAGATATATGACACATACATACGGACCAAGGCCCTT
TCAATAGTCTATTCTTGCACCTCTATGCTGGGGGCGATGAGTGGTGTTTA
TAATGCAGAAACGAGTTCTCTAGTAGTTCCTTTGCTTAAACCATGGATGG
AACAATTTTCTTCTATTCTAGAAGTCCCGGTTCAATCTGAAAATCCAGAT
GATTGGAGTATTAGAATGGAGGTTTTGAAGTGCTTGAATCAGTTTATTCA
GAATTTCTCAAGCCTAATTAAAAGTCAATTTGAAGTCATATTGGGACCAC
TGTGGAATACATTTGTCTCCTCTCTGAGAGTTTATGAGCAGGCATCTATT
GAAGGAGCAGAAGATTCATATGAGGGAAGATATGATTCTGATGGCTCAGA
GATAAGCCTTGATTCATTTGTTATCCAGCTGTTTGAACTTCTGCTGACCA
TTGTCGGTAATTCAAGACTAGCAAAGGCGGTTGCAGCTAATGTCAAAGAA
TTGGTGTACTACACTATTGCTTTTCTTCAAATGACAGAACAGCAGGTTCA
TACGTGGTCTGCAGATGCCAACCAGTTTATTTCTGATGAAGAGGATGCCA
CTTATAGCTGCCGCATTTCTGGCGTGCTTTTACTGGAAGAGGTGGTCAAT
TCTTTTGATGGTGAAGGATTTCTGGCAATCATAGATGCTGCAAAACAATG
GTTCACCGAGTCTCAAATAAGGAAAGTAGCAGGCAATGCAAGCTGGTGGA
GGATAAGAGAAGCTACTCTTTTTGCCTTGTCATCTCTTTCAGAGCAACTG
CTTGAGTCAGAGGAGTCAGGGTTGAAGACAAGTAACTTGAAGGACATGAT
TGAGCAGATTGTTGCCGAGGACTTTCTAATAGATTCTCTTGAATACCCCT
TTCTATATGCTCGTATTTTTACTTCAGTTGCTAAATTCTCCTCTGTGATA
AGCAGTGGTGTACTAGAGCACTCTCTCGATGCAGCATTGAAGGCAATTAC
AATGAACGTGCCTCCACCTGTAAAAGTAGGTGCCTGCAGGGCACTTTCTC
AGCTTCTCCCTAAAGCAAAGAAAGAAATTGTCCAACCACAATTACCGGGT
TTATTTTCATCCCTCACAGATCTTCTTAATCATGCATCGGATGAAACATT
GCACATGGTACTTGAAACATTGCAAGAAGCAGTAAAGGCAGGCCATGAAT
CACCAGCAGTAGTAGAAAGTGTTATATCTCCGGTAATCCTTAATGTATGG
GCATCACATGTTTTGGATCCTTTTATCAGTATTGATGCACTTGAAGTTCT
TGAGGCAATCAAAAGCATTCCCGGATGTATACATCCATTGGTTTCGAGAA
TTTTGCCATATATTGGACCAATTTTAAATGAACCCCAAGAGCAGGCTGAT
GGTTTGGTAGCCGGTTCACTAGATCTGGTAACAATGTTACTGAAGAATGC
CCCTGGTGATGTAATCAAAGCAATATACTATGTCTGTTTCGATGCTGTTA
TCAGAATTATCCTTCAAAGTGATGAGCACAGTGAAATTCAGAATGCTACA
GAATGTTTATCTGCTTTTATATCCGGGGGAAGACAAGAAGTTCTTCTTTG
GGGACCTGATTCTGGATCAACTATGAGAAGCTTACTTGATATAGCTTCCA
GACTACTAGACCCAAATTTGGAAAGCTCCGGGTCTCTTTTTGTTGGGAGT
TATATTCTTCAACTCATATTGCATTTACCATCACAAATGGCTGTACATAT
ACGCGACCTGGTTGCTGCTCTTGTCAGACGCATGCAATCTGCTCAAATTG
CTTCCCTTAGAAGCTCATTGCTAGTTGTTTTTGCCAGATTGGTACACATG
AGTGTTCCTAATGTTGGCCAATTTATTGATTTGCTAATTTCAATTCCAGC
TGAGGGACACAATAATTCCTTTGCTTATGTAATGTCAGAATGGGCTAAGC
AACAAGGTGAGATACAGGGGGCATATCAAATAAAAGTTACTACAAGTGCC
CTGGCCTTGTTGCTAACCAGCAGGCACAATGAACTGGCAAAAATAGAAGT
CCGAGGTCATCTGATTAAGTCTTGCACAGGAATAACCACTAGATCAAAAG
CTAAATCAACTCCAGATCAGTGGGTAATGCTGCCACTTCCTACAAAGATT
GTGGCTTTACTGGCAGATGCATTAACTGAAATACAAGAACAAGTTTTGGA
TGGCGAAGATGAGGATAGTGATTGGGAAGAAGTTCAAACAGATGGTATTG
AAAACGATAAAGGATTTCTTTGTTCAATGTCAAATCCAGGAAAACCCACG
TATGAAAATCTTGAAGCAATGGCCAAAGCGTTCAATGAGGATCAAGATGA
TCAGTATGATGACGACGTTTTAACTGTTGCCGATCCACTTAATCAGATAA
ATCTGGTAAATTACCTTGTGGATTTCTTTGCTAACTTCGCACAGAGTGAC
AGAGAGCTCTTAGATCACATTTGCAAGAGCTTGACTCAGCCTCAACAAAA
TGCAATTAAAATGGTATTGCAGAGATGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR001494Importin-beta, N-terminal
IPR011989Armadillo-like helical
IPR016024Armadillo-type fold
noIPRunintegrated
Vocabulary: Biological Process
TermDefinition
GO:0006886intracellular protein transport
GO:0007165signal transduction
GO:0007154cell communication
GO:0008150biological_process
GO:0009987cellular process
GO:0023052signaling
GO:0044699single-organism process
GO:0044700single organism signaling
GO:0044763single-organism cellular process
GO:0050789regulation of biological process
GO:0050794regulation of cellular process
GO:0050896response to stimulus
GO:0051716cellular response to stimulus
GO:0065007biological regulation
Vocabulary: Molecular Function
TermDefinition
GO:0008565protein transporter activity
GO:0005488binding
GO:0005515protein binding
GO:0003674molecular_function
GO:0005215transporter activity
GO:0022892substrate-specific transporter activity
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0044424intracellular part
GO:0044464cell part