Overview
NameMedtr0010s0190.1
Unique NameMedtr0010s0190.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length333
Homology
BLAST of Medtr0010s0190.1 vs. NCBI nr
Match: gi|388507916|gb|AFK42024.1| (unknown [Lotus japonicus])
BLAST of Medtr0010s0190.1 vs. NCBI nr
Match: gi|502095089|ref|XP_004490371.1| (PREDICTED: RING-H2 finger protein ATL47-like [Cicer arietinum])
BLAST of Medtr0010s0190.1 vs. NCBI nr
Match: gi|502095084|ref|XP_004490370.1| (PREDICTED: RING-H2 finger protein ATL47-like [Cicer arietinum])
BLAST of Medtr0010s0190.1 vs. NCBI nr
Match: gi|502178080|ref|XP_004516175.1| (PREDICTED: RING-H2 finger protein ATL54-like [Cicer arietinum])
BLAST of Medtr0010s0190.1 vs. NCBI nr
Match: gi|502095094|ref|XP_004490372.1| (PREDICTED: RING-H2 finger protein ATL54-like [Cicer arietinum])
BLAST of Medtr0010s0190.1 vs. NCBI nr
Match: gi|118486923|gb|ABK95295.1| (unknown [Populus trichocarpa])
BLAST of Medtr0010s0190.1 vs. NCBI nr
Match: gi|224108589|ref|XP_002314901.1| (hypothetical protein POPTR_0010s14330g [Populus trichocarpa] >gi|222863941|gb|EEF01072.1| hypothetical protein POPTR_0010s14330g [Populus trichocarpa])
BLAST of Medtr0010s0190.1 vs. NCBI nr
Match: gi|224097678|ref|XP_002334595.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0010s0190.1 vs. NCBI nr
Match: gi|224108591|ref|XP_002314902.1| (hypothetical protein POPTR_0010s14370g [Populus trichocarpa] >gi|222863942|gb|EEF01073.1| hypothetical protein POPTR_0010s14370g [Populus trichocarpa])
BLAST of Medtr0010s0190.1 vs. NCBI nr
Match: gi|255546935|ref|XP_002514525.1| (conserved hypothetical protein [Ricinus communis] >gi|223546129|gb|EEF47631.1| conserved hypothetical protein [Ricinus communis])
The following BLAST results are available for this feature:
BLAST of Medtr0010s0190.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 16
Match NameE-valueIdentityDescription
gi|388507916|gb|AFK42024.1|1.500350e-2843.57unknown [Lotus japonicus][more]
gi|502095089|ref|XP_004490371.1|1.307400e-2441.04PREDICTED: RING-H2 finger protein ATL47-like [Cice... [more]
gi|502095084|ref|XP_004490370.1|1.408730e-2441.04PREDICTED: RING-H2 finger protein ATL47-like [Cice... [more]
gi|502178080|ref|XP_004516175.1|6.106220e-2240.44PREDICTED: RING-H2 finger protein ATL54-like [Cice... [more]
gi|502095094|ref|XP_004490372.1|3.166180e-2139.71PREDICTED: RING-H2 finger protein ATL54-like [Cice... [more]
gi|118486923|gb|ABK95295.1|1.582440e-1434.04unknown [Populus trichocarpa][more]
gi|224108589|ref|XP_002314901.1|1.946230e-1434.04hypothetical protein POPTR_0010s14330g [Populus tr... [more]
gi|224097678|ref|XP_002334595.1|2.028430e-1434.04predicted protein [Populus trichocarpa][more]
gi|224108591|ref|XP_002314902.1|9.736370e-1434.29hypothetical protein POPTR_0010s14370g [Populus tr... [more]
gi|255546935|ref|XP_002514525.1|5.822380e-1131.16conserved hypothetical protein [Ricinus communis] ... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0010s0190.1 ID=Medtr0010s0190.1|Name=Medtr0010s0190.1|organism=Medicago truncatula|type=mRNA|length=333bp
ATGATCATGAAATATTTTACTCTAGTTTACTCTCATTTAAAATGGGTGTT
AGATTTCCTTCTCTTCTATCCCTTTTACAATCTCTATGATCCTCACTTGC
AAGACATTGGAGAAGAGGTTTCTAGGTTACATGATGAATCAACTCTTGAC
TCAGAGGAATATGTTGATTGTGCTGTGTGTCTTAGCAAAATTGGAGAAGG
AGAGGTTACAAGAGTACTGAGAAAAGCAGTTAGTCCAAGAAGTATTATTA
GTGAATTTGGAACAGAAGTTTTATTTTTTGAGTTTTTTTCTGTTCATGCA
AATGATGACAATGATACTTGGTGGCTACGTTGA
back to top