Overview
NameMedtr0010s0050.1
Unique NameMedtr0010s0050.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length435
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0009790 embryo development
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
molecular_function GO:0008270 zinc ion binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00097.2027662-2779374-1171-4130.85.2e-1130.81.4e-07
PF12861.227713-2780291-12051-8024.94.3e-0924.91.2e-05
PF13639.127659-2779973-1192-4556.65.1e-1956.61.4e-15
PF13920.127659-2781173-1234-4928.23.6e-1028.29.9e-07
PF13923.127656-2779672-1183-4531.73.2e-1131.78.7e-08

Homology
BLAST of Medtr0010s0050.1 vs. NCBI nr
Match: gi|388507916|gb|AFK42024.1| (unknown [Lotus japonicus])
BLAST of Medtr0010s0050.1 vs. NCBI nr
Match: gi|502095094|ref|XP_004490372.1| (PREDICTED: RING-H2 finger protein ATL54-like [Cicer arietinum])
BLAST of Medtr0010s0050.1 vs. NCBI nr
Match: gi|502178080|ref|XP_004516175.1| (PREDICTED: RING-H2 finger protein ATL54-like [Cicer arietinum])
BLAST of Medtr0010s0050.1 vs. NCBI nr
Match: gi|502095084|ref|XP_004490370.1| (PREDICTED: RING-H2 finger protein ATL47-like [Cicer arietinum])
BLAST of Medtr0010s0050.1 vs. NCBI nr
Match: gi|502095089|ref|XP_004490371.1| (PREDICTED: RING-H2 finger protein ATL47-like [Cicer arietinum])
BLAST of Medtr0010s0050.1 vs. NCBI nr
Match: gi|297737919|emb|CBI27120.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0010s0050.1 vs. NCBI nr
Match: gi|297737915|emb|CBI27116.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0010s0050.1 vs. NCBI nr
Match: gi|359473022|ref|XP_003631232.1| (PREDICTED: RING-H2 finger protein ATL47-like [Vitis vinifera] >gi|297737916|emb|CBI27117.3| unnamed protein product [Vitis vinifera])
BLAST of Medtr0010s0050.1 vs. NCBI nr
Match: gi|590612309|ref|XP_007022349.1| (RING/U-box superfamily protein, putative [Theobroma cacao] >gi|508721977|gb|EOY13874.1| RING/U-box superfamily protein, putative [Theobroma cacao])
BLAST of Medtr0010s0050.1 vs. NCBI nr
Match: gi|147860139|emb|CAN82925.1| (hypothetical protein VITISV_039591 [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0010s0050.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|388507916|gb|AFK42024.1|1.446080e-2443.20unknown [Lotus japonicus][more]
gi|502095094|ref|XP_004490372.1|2.448260e-1837.82PREDICTED: RING-H2 finger protein ATL54-like [Cice... [more]
gi|502178080|ref|XP_004516175.1|7.873210e-1840.00PREDICTED: RING-H2 finger protein ATL54-like [Cice... [more]
gi|502095084|ref|XP_004490370.1|3.068480e-1740.68PREDICTED: RING-H2 finger protein ATL47-like [Cice... [more]
gi|502095089|ref|XP_004490371.1|2.377830e-1638.98PREDICTED: RING-H2 finger protein ATL47-like [Cice... [more]
gi|297737919|emb|CBI27120.3|7.658770e-1640.91unnamed protein product [Vitis vinifera][more]
gi|297737915|emb|CBI27116.3|2.391020e-1545.35unnamed protein product [Vitis vinifera][more]
gi|359473022|ref|XP_003631232.1|4.586930e-1544.83PREDICTED: RING-H2 finger protein ATL47-like [Viti... [more]
gi|590612309|ref|XP_007022349.1|2.731810e-1438.83RING/U-box superfamily protein, putative [Theobrom... [more]
gi|147860139|emb|CAN82925.1|3.194760e-1444.83hypothetical protein VITISV_039591 [Vitis vinifera... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001841Zinc finger, RING-typeSMARTSM00184no descriptioncoord: 74..117
score: 2.6
IPR001841Zinc finger, RING-typePROFILEPS50089ZF_RING_2coord: 74..118
score: 13
IPR013083Zinc finger, RING/FYVE/PHD-typeGENE3D3.30.40.10no descriptioncoord: 69..121
score: 4.1
NoneNo IPR availableSUPERFAMILY57850RING/U-boxcoord: 47..124
score: 1.8

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0010s0050.1 ID=Medtr0010s0050.1|Name=Medtr0010s0050.1|organism=Medicago truncatula|type=mRNA|length=435bp
ATGAGCCCTCTGATTAGAATCGCATTAGCAATAAACTCCTTTTCTTGCTC
CCATACCTTAAGAAACCTCATGAAATACTCAACTCTCCTCCATATTTTTC
TAAACTCAATATTCAATTTCTTTTTCTACTATCTACGCAATCCCTTATGC
AAGCATAAGAGTTCTGATCATCATCTAAGTGTATGCCAATATGTGTCCCA
ATCACAAAAAGAAGTAGATTGTGCTGTGTGTCTCTGCACGATGAAAGAAA
AGGAAGAGATTAGAGTGCTACGGTGTGAACATGTGTTTCACAAAGATTGT
TTCGATACATGGATTAGATACAAATACAATAATACAACTTGCCCTCTTTG
CAGAGTTTCAGTAGGTTCAATAAGAGAGGTTGATGCTCAAGTTATAGTAC
ATGATCATTTTCATGAATTACCGTGGCTAAGGTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR001841Zinc finger, RING-type
IPR013083Zinc finger, RING/FYVE/PHD-type
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0008270zinc ion binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0007275multicellular organismal development
GO:0009790embryo development
GO:0008150biological_process
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048856anatomical structure development