Overview
NameMedtr0009s0500.2
Unique NameMedtr0009s0500.2
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length240
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0009s0500.2 ID=Medtr0009s0500.2|Name=Medtr0009s0500.2|organism=Medicago truncatula|type=mRNA|length=240bp
CTCAAAACTTTCATAGATCGTGCAAATTCATTCTATAACCACCGTCTCTT
TGGTTCATTCATTCATTCATCACCATCACCACCTATATCTCATTCTTCCT
TCCAGGTGAAAGAAGATTCCAAAATATGGAAGTGCATTGTGATCTATCTT
ATTGTTTATGTAACATCTTCTATGGCTTGTTATGTTATGGGAAAAAGGTT
GAGACGACCAAGATTGAGGATGAGATTGCATGCTACCTAA
back to top