Overview
NameMedtr0005s0200.1
Unique NameMedtr0005s0200.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length3468
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0007154 cell communication
biological_process GO:0009987 cellular process
biological_process GO:0006952 defense response
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00931.17284238-285077194-4734-285232.87.1e-73234.11.3e-69

Homology
BLAST of Medtr0005s0200.1 vs. NCBI nr
Match: gi|502164798|ref|XP_004513269.1| (PREDICTED: putative disease resistance RPP13-like protein 1-like isoform X1 [Cicer arietinum] >gi|502164800|ref|XP_004513270.1| PREDICTED: putative disease resistance RPP13-like protein 1-like isoform X2 [Cicer arietinum])
BLAST of Medtr0005s0200.1 vs. NCBI nr
Match: gi|297745513|emb|CBI40678.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0005s0200.1 vs. NCBI nr
Match: gi|359486054|ref|XP_003633379.1| (PREDICTED: putative disease resistance protein At3g14460-like [Vitis vinifera])
BLAST of Medtr0005s0200.1 vs. NCBI nr
Match: gi|359486086|ref|XP_002273714.2| (PREDICTED: putative disease resistance RPP13-like protein 1-like [Vitis vinifera])
BLAST of Medtr0005s0200.1 vs. NCBI nr
Match: gi|590584019|ref|XP_007015058.1| (LRR and NB-ARC domains-containing disease resistance protein, putative [Theobroma cacao] >gi|508785421|gb|EOY32677.1| LRR and NB-ARC domains-containing disease resistance protein, putative [Theobroma cacao])
BLAST of Medtr0005s0200.1 vs. NCBI nr
Match: gi|147780319|emb|CAN70245.1| (hypothetical protein VITISV_027660 [Vitis vinifera])
BLAST of Medtr0005s0200.1 vs. NCBI nr
Match: gi|359486065|ref|XP_003633380.1| (PREDICTED: putative disease resistance RPP13-like protein 1-like [Vitis vinifera])
BLAST of Medtr0005s0200.1 vs. NCBI nr
Match: gi|147841490|emb|CAN77617.1| (hypothetical protein VITISV_037152 [Vitis vinifera])
BLAST of Medtr0005s0200.1 vs. NCBI nr
Match: gi|596017798|ref|XP_007218891.1| (hypothetical protein PRUPE_ppa000343mg [Prunus persica] >gi|462415353|gb|EMJ20090.1| hypothetical protein PRUPE_ppa000343mg [Prunus persica])
BLAST of Medtr0005s0200.1 vs. NCBI nr
Match: gi|359486059|ref|XP_002271783.2| (PREDICTED: putative disease resistance RPP13-like protein 1-like [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0005s0200.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502164798|ref|XP_004513269.1|0.000000e+078.86PREDICTED: putative disease resistance RPP13-like ... [more]
gi|297745513|emb|CBI40678.3|0.000000e+045.84unnamed protein product [Vitis vinifera][more]
gi|359486054|ref|XP_003633379.1|2.617980e-844.20PREDICTED: putative disease resistance protein At3... [more]
gi|359486086|ref|XP_002273714.2|0.000000e+042.98PREDICTED: putative disease resistance RPP13-like ... [more]
gi|590584019|ref|XP_007015058.1|0.000000e+041.93LRR and NB-ARC domains-containing disease resistan... [more]
gi|147780319|emb|CAN70245.1|0.000000e+044.14hypothetical protein VITISV_027660 [Vitis vinifera... [more]
gi|359486065|ref|XP_003633380.1|0.000000e+042.01PREDICTED: putative disease resistance RPP13-like ... [more]
gi|147841490|emb|CAN77617.1|0.000000e+042.35hypothetical protein VITISV_037152 [Vitis vinifera... [more]
gi|596017798|ref|XP_007218891.1|1.085390e-1044.12hypothetical protein PRUPE_ppa000343mg [Prunus per... [more]
gi|359486059|ref|XP_002271783.2|0.000000e+042.33PREDICTED: putative disease resistance RPP13-like ... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000767Disease resistance proteinPRINTSPR00364DISEASERSISTcoord: 214..229
score: 7.6e-17coord: 287..301
score: 7.6e-17coord: 384..398
score: 7.6e-17coord: 636..652
score: 7.6
NoneNo IPR availableGENE3D3.80.10.10no descriptioncoord: 868..923
score: 2.2e-28coord: 924..1129
score: 1.9
NoneNo IPR availableSEGsegsegcoord: 54..67
score
NoneNo IPR availableSUPERFAMILY52047RNI-likecoord: 895..1153
score: 1.3
NoneNo IPR availableSUPERFAMILY52058L domain-likecoord: 507..908
score: 4
NoneNo IPR availableSUPERFAMILY52540P-loop containing nucleoside triphosphate hydrolasescoord: 168..420
score: 5.3

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0005s0200.1 ID=Medtr0005s0200.1|Name=Medtr0005s0200.1|organism=Medicago truncatula|type=mRNA|length=3468bp
ATGGCAGCCATGTCACTTGAAATGTCCACATGGCATGTCAGAGTCAGCAT
TTTGTTAGCCAGTCAACACAGTTTGACAGCTCATTTGTCTGCAATCTTGC
AAGTACTGTTGGATAGGATAGCTCATCCTGATTTTATCGACTTCTTTCGA
GGAAACCATCTTGATGAGACACTTCTAGACAAGTTGAAGATGCTTTTGCT
ATCTGTCACTATAGTGCTTAATGATGCTGAGGAGAAGCAGTTTTTTGATC
CATTCGTGAAGGAATGGGTTGATAAGCTTAAGAATGCTGCCTATGATGCT
GATGATGTCTTGGATGAGATTGCCACCAAAGCCATACAAGACAAGATGGA
TCCTAGGTTCAACACAACCATACATCAGGTAAAAGATTATGCTTCCTCTC
TCAATCCCTTTTCTAAACGAGTTCAATCTAAAATTGGTAGGATAGTTGAG
AGGTTGAAATCTATATTAGAGCATAAAAATCTTCTTGGTCTTAAGGAAGG
AGGTGTAGGTAAACCACTCTCGTTAGGTTCAGAGACAACTTCTTTGGTGG
ATGAACATCGTGTGTACGGTAGACATGGTGATAAGGAGAAGATTATAGAC
TTCTTGTTGGCTGGAGACTCCAATGGAGAGTGGGTGCCGGTAGTTGCGAT
TGTTGGAACGGGAGGGGTAGGAAAGACTACTCTTGCTCAAGTTTTGTACA
ATGATGAACGTGTGAGGAACCATTTTCAATCTAGATCATGGGCCTCGGTG
TCAGAGACTTCAAATGTGAATGAAATAACCAGAAAAGCTTTTGAGTATTT
CACTTTGATGTATTCTAATATCTCAGACTTGAATATACTCCAAATCAAAC
TTAAGGATAGACTGGACGGACAAAGGTTTCTACTTGTTCTGGATGGGTTT
TGGAATGAGAACTTTCTTGACTGGGATATCTTCCAAAGACCCTTTCTATC
AGGAAACTATGGTAGCAGAATCATTGTCACAACGCGTAGTCAAAGTTTTG
CAACATTGATCGGTGCTGATTTAAATCATTCCCTCTCGCATTTATCTCAT
GAAGATACTTGGAAGTTATTCGCTAGTCATGCATTCAAATCAGTGAACCC
GACCGAGCATCCCATGTTGGCTCAAATTGGCCAAAAAATAGTAAAAAAGT
GCAATGGTCTCCCTCTAGCCGCAAAAGCACTAGGGAGTCTCCTACGTACA
AAAGATGTTGGGGAGTGGGAAGGTATATGTTATAGTAGGATATGGGAATT
ACCAACTGATAAGTGTAGCATTCTTCCTGCCTTAAGATTGAGCTACAGTC
ATCTACCTTCTCATTTAAAGCGATGTTTTACTTATTGTTCCATATTTCCA
AAAGGATATGAAATAAAAAAGTGGAACTTGATCTATTTATGGATGGCTGA
AGGTATCCTACCACAACAAAGAACGGATAAGAGAATGGAAGATGTAAGAG
AAGAATGCTTTGAAGTGTTACTATCTAGATCGTTCTTTTATCAATCAACC
TACCATGCATCACATTATATGATGCATGACCTTATCCATGATGTAGCACA
ATTTGTTGCAGGTGAATTCTGTTACAACTTAGATGATAACAATCCAAGAA
AAATCACGACTATTGTTCGCCATTTATCTTATTTACAAGGTATATATGAT
GATCCAGAAAAGTTTGAGATCTTTTCTGAATTTAAGCAGCTTAGAACCTT
CATACCATTCAAATTCTCATACTTTGTTTACTCCTCTTCAATTACTAGCA
TGGTTTCAATTTTGTTACCAAAATTGAAACGCTTGCGTGTGCTCTCCTTG
TCTCATTATCCAATTACGAATTTGTCAGATTCAATTGGAGTTTTGATGCA
TATGCGGTATTTGGATCTTTCTTACACAGGAATTGAGTGTTTGCCTGATT
CAGTGAGCACTTTGTATAACTTGGAGACGTTGTTGTTATCCGGTTGTCGT
TGTCTCACTATATTACCAGAAAACATGTCCAACCTCATCAACTTGCGCCA
ACTTGATATTAGTGGAAGCACCGTTACATCAATGCCTCCAAAATTTGGTA
AATTGAAGTCTCTTCAAGTTTTGACCAATTTTACAGTAGGCAATGCAAGG
GGATCGAAAATTGGTGAGCTAGGGAAGCTTTCGAAACTCCACGGAACACT
TTCAATTGGGAGCCTACAAAATGTAATTGATGCAATAGAAGCCTCTCATG
TCCAGTTGAAGAGTAAGAAATGTCTTCATGAACTAGAATTCAAGTGGTCA
ACTACAACTCATGATGAAGAGAGTGAAACTAATGTACTCGACATGCTTGA
GCCACATGAAAATGTAAAGAGACTTCTTATCCAGAATTTTGGCGGCAAAA
AATTGCCAAATTGGTTAGGGAACTCTCCATTTTCTAGCATGGTGTTTCTA
CAACTAACTAGTTGTGAAAATTGCAAGTCACTGCCATCACTTGGACAATT
GTCCTGCCTCGAAGAACTTTGTATATCAAAGATGAAAAGTTTACAGAAGG
TTGGTCTAGAATTCTATGGGAATGTAATTGAGCCATTCAAATCATTGAAA
ATTATGAAATTTGAGGACATGCCCAGTTGGGAAGAATGGTCAACCCATAG
ATTTGAAGAGAATGAGGAGTTCCCTTCACTCCTAGAACTTCACATAGAGA
GATGTCCAAAATTCACCAAAAAGCTACCTGACCACCTCCCTTCCTTAGAT
AAATTAATGATCACTGGATGCCAAGCTCTAACAAGTCCAATGCCATGGGT
TCCAAGACTGAGAGAATTAGTGCTGACCGGTTGTGACGCGTTAGTGTCAT
TATCTGAGAAAATGATGCAGGGAAATAAATGTCTTCAAATCATTGCCATA
AACAATTGCTCATCTCTTGTCACAATCTCTATGAATGGTCTACCAAGTAC
ATTAAAATCACTTGAAATCTATGAGTGCAGAAATTTACAACTATTTCATC
CCCAGAGTTTGATGCTGGATTCTCACTACTATTTTTCCCTTGAAAAATTA
CACTTAAGATGTTGTGATTCTCTGATCTCATTTCCGCTATCCCTCTTCCA
CAAATTTGAAGATTTACATGTACAAAATTGCAACAATCTCAATTTTATTT
CCTGTTTTCCTGAAGGAGGGTTGCATGCTCCAAAACTTGAGTCTCTTTCC
ATCATCAAATGTGTTGATTTCTCATCTGAGACTGCATGGTGTCTTCAGAC
AATGACATCTCTATCTTCTCTTCACATCAGTGGACTTCCTAGTCTCACTT
CACTAGAGAATACAGGAGTTCAGTTCCTAACATCTCTCAAAAGTTTGAAG
ATTAAAGCTTGTTTTAACCTTGGATCTCTTCCTTTAGACACACTAGTTAA
CTCCCTTTCTCATCTTACTATCAGAGCATGTCCATTGTTAAAACTGCTAT
GTAAAAAAGACACGGGGGAATACTGGAGTATGGTCTCTCGCATACCCTTC
AGAATCATTGAAGACTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000767Disease resistance protein
noIPRunintegrated
Vocabulary: Biological Process
TermDefinition
GO:0006952defense response
GO:0007154cell communication
GO:0008150biological_process
GO:0009987cellular process
GO:0044699single-organism process
GO:0044763single-organism cellular process
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0044464cell part