Overview
NameMedtr0005s0130.1
Unique NameMedtr0005s0130.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length2001
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
molecular_function GO:0003676 nucleic acid binding
molecular_function GO:0000166 nucleotide binding
molecular_function GO:0008270 zinc ion binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00076.17206718-206575335-38210-6031.42.1e-1132.64.1e-08
PF00642.19207156-207094189-2095-2624.23.7e-0925.28.5e-06
PF14259.1206721-206569334-3849-6130.45.6e-1133.23.6e-08

Homology
BLAST of Medtr0005s0130.1 vs. NCBI nr
Match: gi|502164796|ref|XP_004513268.1| (PREDICTED: zinc finger CCCH domain-containing protein 53-like [Cicer arietinum])
BLAST of Medtr0005s0130.1 vs. NCBI nr
Match: gi|356529848|ref|XP_003533499.1| (PREDICTED: zinc finger CCCH domain-containing protein 53-like isoform X1 [Glycine max])
BLAST of Medtr0005s0130.1 vs. NCBI nr
Match: gi|356542895|ref|XP_003539900.1| (PREDICTED: zinc finger CCCH domain-containing protein 53-like [Glycine max])
BLAST of Medtr0005s0130.1 vs. NCBI nr
Match: gi|356542909|ref|XP_003539907.1| (PREDICTED: zinc finger CCCH domain-containing protein 53-like isoform X1 [Glycine max])
BLAST of Medtr0005s0130.1 vs. NCBI nr
Match: gi|356531625|ref|XP_003534377.1| (PREDICTED: zinc finger CCCH domain-containing protein 53-like [Glycine max])
BLAST of Medtr0005s0130.1 vs. NCBI nr
Match: gi|502127572|ref|XP_004499759.1| (PREDICTED: zinc finger CCCH domain-containing protein 53-like isoform X3 [Cicer arietinum])
BLAST of Medtr0005s0130.1 vs. NCBI nr
Match: gi|502127567|ref|XP_004499757.1| (PREDICTED: zinc finger CCCH domain-containing protein 53-like isoform X1 [Cicer arietinum] >gi|502127569|ref|XP_004499758.1| PREDICTED: zinc finger CCCH domain-containing protein 53-like isoform X2 [Cicer arietinum])
BLAST of Medtr0005s0130.1 vs. NCBI nr
Match: gi|590561204|ref|XP_007008744.1| (Zinc finger family protein / RNA recognition motif-containing protein isoform 1 [Theobroma cacao] >gi|508725657|gb|EOY17554.1| Zinc finger family protein / RNA recognition motif-containing protein isoform 1 [Theobroma cacao])
BLAST of Medtr0005s0130.1 vs. NCBI nr
Match: gi|224072821|ref|XP_002303898.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0005s0130.1 vs. NCBI nr
Match: gi|38230504|gb|AAR14273.1| (predicted protein [Populus tremula x Populus alba])
The following BLAST results are available for this feature:
BLAST of Medtr0005s0130.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502164796|ref|XP_004513268.1|0.000000e+074.64PREDICTED: zinc finger CCCH domain-containing prot... [more]
gi|356529848|ref|XP_003533499.1|0.000000e+067.86PREDICTED: zinc finger CCCH domain-containing prot... [more]
gi|356542895|ref|XP_003539900.1|0.000000e+067.13PREDICTED: zinc finger CCCH domain-containing prot... [more]
gi|356542909|ref|XP_003539907.1|0.000000e+066.48PREDICTED: zinc finger CCCH domain-containing prot... [more]
gi|356531625|ref|XP_003534377.1|0.000000e+067.08PREDICTED: zinc finger CCCH domain-containing prot... [more]
gi|502127572|ref|XP_004499759.1|0.000000e+063.76PREDICTED: zinc finger CCCH domain-containing prot... [more]
gi|502127567|ref|XP_004499757.1|0.000000e+063.59PREDICTED: zinc finger CCCH domain-containing prot... [more]
gi|590561204|ref|XP_007008744.1|0.000000e+056.38Zinc finger family protein / RNA recognition motif... [more]
gi|224072821|ref|XP_002303898.1|0.000000e+056.81predicted protein [Populus trichocarpa][more]
gi|38230504|gb|AAR14273.1|0.000000e+055.24predicted protein [Populus tremula x Populus alba][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000504RNA recognition motif domainSMARTSM00360no descriptioncoord: 324..394
score: 9.4
IPR000504RNA recognition motif domainPROFILEPS50102RRMcoord: 323..399
score: 10
IPR000571Zinc finger, CCCH-typeSMARTSM00356no descriptioncoord: 186..210
score: 0.0
IPR000571Zinc finger, CCCH-typePROFILEPS50103ZF_C3H1coord: 184..211
score: 14
IPR012677Nucleotide-binding, alpha-beta plaitGENE3D3.30.70.330no descriptioncoord: 334..404
score: 5.4
NoneNo IPR availableCOILcoilcoiled-coilcoord: 450..471
score
NoneNo IPR availableGENE3D4.10.1000.10no descriptioncoord: 188..210
score: 0.0
NoneNo IPR availableSEGsegsegcoord: 66..83
score: NAcoord: 85..98
score: NAcoord: 211..217
score: NAcoord: 248..253
score: NAcoord: 270..289
score: NAcoord: 448..467
score: NAcoord: 519..532
score: NAcoord: 548..565
score: NAcoord: 566..582
score
NoneNo IPR availableSUPERFAMILY54928RNA-binding domain, RBDcoord: 318..401
score: 2.9
NoneNo IPR availableSUPERFAMILY90229CCCH zinc fingercoord: 182..210
score: 5.8

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0005s0130.1 ID=Medtr0005s0130.1|Name=Medtr0005s0130.1|organism=Medicago truncatula|type=mRNA|length=2001bp
ATGGATGGTTATGAAGCAACTAAGATGGTGTTTTCAAGGATCAAAAGCAT
GGACCCTGAAAATGCATCAAATATCATGGGTTTGCTTCTTAGTAAAGAAC
ATGGTGAGAAAGAAATGATAAGATTAGCATTAAGTCCTGAATCACTTATT
CACTCAGTGATATTCAAAGCTAGAAAAGAGTTAGGACTACCTTGTTCTAA
TAACTCTCCACCAACACCTTCATCAACTTCTCCATCACCATCACCTAATT
TCCTTTCAAGGCAAAATTCATCAACTTCTTCAAGGCTTAGTAGTGGTTTC
AACCTTCCACCTTCTCTAACCATCCCTAACCCTTCTTGGGGAGCTACTAC
TACTACTATGTCTATGTCTGATCAGTTTCAAAACCATGATGATTCAGATC
CAATTGATGATTTCCAACTCCAAGACCAACTTTCTTTCTTGAATGATGGT
TCTGATCCTTCATATGGTTGGGGAGGTAATTCTTCTCTTCATAGGAGAAG
TTGTTCTGTGAATGATGCTTATTTAGCTGGTTCTGAGGATCCAAGTGCTG
GTTTAGGGTGGAAGCCATGTCTTTATTTTGCAAGAGGGTACTGTAAAAAT
GGTACTAGTTGTAGGTTCCTTCATGGTGATGCTTCCGCTGCTGCTGCTGC
AATTGTTGGATCTCCTAACAAGATTGAAAATATGATGGATCAGTATCATC
ATGAACTCTTGAGATCTAAATCTTCTCATCAACAAAGATTTGCTGCTGCT
GCTGCTGCTTCTCAACTCATGGCCTCTAACTCTTTCCTTTGCTCACCAAA
AGGCATGAATTTCCTTTTACAGCAGCAACAAAATCAAAATGATACTCAAA
GGGCAGCTGCTGCAGCTCTAATGATGAATGAGGAGTTGCACAAATTTGGA
AGATCAAGGCTTGAAAGAAATGATTTTTCTTTGTACAGTCCTACTGGAAT
GATTAACCCAGCTTCAAGACAAATCTACTTGACTTTCCCAGCTGATAGTA
CTTTCAGAGAGGAAGATGTTTCAGAATACTTCAGCAAATTTGGTCCTGTT
CAAGATGTGAGGATTCCATACCAGCAGAAGCGTATGTTTGGCTTTGTTAC
ATTTGTTTTTCCAGAGACAGTGAAGGACATTTTGTCTAAAGGAAACCCTC
ATTTTGTTTGCGAGGCTCGAGTACTTGTTAAGCCTTACAAGGAGAAGGGT
AAAATCCCAGATAAGAAGCAGCTTCAGCAGCAGGGAGATTTTTCACCGTG
TCGCACTCCAACTGGACTTGTTGATGCTAGAGACCAATACGATCTTCAAC
TTGCTGAAAGAATGTTCTATAACACAGAAGACATGTTGTGGAGGAGGAAG
GAGCAAGCTGAGTTGCAACAACAAGCTCTTGAGATTCAACGTAGGAGGTT
AATGGGGCTGCAACTTCTCGACATCAAGAACCAACACCAACGTGCACTTT
CCACCGGAAGTCTAGTCCATTCTCCTACTCAATCTCCTAACATGTTCGAT
CAGAATCTTGTACTTCCTTTTCGCAGAAGCTCCGAGTTCTCAGATGTGAT
TGGTTCAAATTCTGCTTCAGCTCATAGTAATGCTTCTGTTTCTGCTGGTC
AACAATCAGTCAAGGGTTATGCTGGGAAGGAAGTGTTGGTCAATGGTGAG
AATGGAAACAGTGAAAGTAATGAAAATGGCAAGACAAGCTCAAGTCATGA
AGAGGAGCTTAATTTACATGAATGTTTGGAATTGGAGCATAATCTACCTG
ATAGCCCTTTTGCTTCCCCTACAAAAGCTGTTGGAGACTTGGTAGGTCCC
TTCTCTAATGGACCATTAGAGACCATTGATTCAGATGCATCTACTAGCTC
TAAATTTGGCACTAGTAAATTACTACCAACTTCAGCTTCTCTTGATATGG
GATCTTTTAAACCATATAATAACTGCCAATTACCAAGGTTTTCTTCTGCC
CATGGAACTATTGGGATGTTTGCCGGCACCGGTGGACCGATCGGCATTTA
G
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000504RNA recognition motif domain
IPR000571Zinc finger, CCCH-type
IPR012677Nucleotide-binding, alpha-beta plait
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0003676nucleic acid binding
GO:0008270zinc ion binding
GO:0000166nucleotide binding