Overview
NameMedtr0004s0600.3
Unique NameMedtr0004s0600.3
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length519
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0051301 cell division
biological_process GO:0009987 cellular process
biological_process GO:0032502 developmental process
biological_process GO:0009790 embryo development
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0005856 cytoskeleton
cellular_component GO:0005622 intracellular
cellular_component GO:0043232 intracellular non-membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0015630 microtubule cytoskeleton
cellular_component GO:0043228 non-membrane-bounded organelle
cellular_component GO:0043226 organelle
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
PhyloFun GO Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0004s0600.3 ID=Medtr0004s0600.3|Name=Medtr0004s0600.3|organism=Medicago truncatula|type=mRNA|length=519bp
ATGGCATCGAGCTTACAGAAAATTGAAGGGGACGAGTCCGTACTATTGCG
CGTTACTCATTCTAATCTCAAATCTTTCAACCCCGACATTCGCTTCTCCC
TACAGCTCACAGTGGAAGCAGTCAAGGACAAGCTATGGAAAAAATGTGGT
ACTTCTGTTAACTCTATGCACCTCGAACTCTACGACGAACTTCGCAATAA
AATCGCCGATCTCTCTGATCATTCCAAACTCCTTGGATTCTATTCTCCTT
TTGATGGGTTTCGTTTGCACGTCGTTGATCTTGATCCAGCCTCTGTTACA
TCGGGTGGATGGTTGGAAGATACTTCTTTGGTGGAGAAATACGAAATTTC
TGAAGAATCTTATAATAAGCGAGGAGACACTTTCAGAAAATATAGGGAGA
AATTGACTTCGCAAGCTCCATCGACTATTGAGGCAAAGACATTAGACACC
GACATGGAAGACATCTGTGCTAATATCAAGGAAAGAGTGACCATGAATGA
GAGGCAACAAGCAAGCTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0005856cytoskeleton
GO:0015630microtubule cytoskeleton
GO:0043226organelle
GO:0043228non-membrane-bounded organelle
GO:0043229intracellular organelle
GO:0043232intracellular non-membrane-bounded organelle
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0007275multicellular organismal development
GO:0009790embryo development
GO:0008150biological_process
GO:0009987cellular process
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044763single-organism cellular process
GO:0044767single-organism developmental process
GO:0048856anatomical structure development
GO:0051301cell division