Overview
NameMedtr0004s0600.2
Unique NameMedtr0004s0600.2
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length618
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0048646 anatomical structure formation involved in morphogenesis
biological_process GO:0009653 anatomical structure morphogenesis
biological_process GO:0008150 biological_process
biological_process GO:0007349 cellularization
biological_process GO:0032502 developmental process
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0071944 cell periphery
cellular_component GO:0005575 cellular_component
cellular_component GO:0016020 membrane
cellular_component GO:0005886 plasma membrane
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01302.20338703-338834161-2041-4545.33.3e-1645.83.1e-12

Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0004s0600.2 ID=Medtr0004s0600.2|Name=Medtr0004s0600.2|organism=Medicago truncatula|type=mRNA|length=618bp
ATGGCATCGAGCTTACAGAAAATTGAAGGGGACGAGTCCGTACTATTGCG
CGTTACTCATTCTAATCTCAAATCTTTCAACCCCGACATTCGCTTCTCCC
TACAGCTCACAGTGGAAGCAGTCAAGGACAAGCTATGGAAAAAATGTGGT
ACTTCTGTTAACTCTATGCACCTCGAACTCTACGACGAACTTCGCAATAA
AATCGCCGATCTCTCTGATCATTCCAAACTCCTTGGATTCTATTCTCCTT
TTGATGGGTTTCGTTTGCACGTCGTTGATCTTGATCCAGCCTCTGTTACA
TCGGGTGGATGGTTGGAAGATACTTCTTTGGTGGAGAAATACGAAATTTC
TGAAGAATCTTATAATAAGCGAGGAGACACTTTCAGAAAATATAGGGAGA
AATTGACTTCGCAAGCTCCATCGACTATTGAGGCAAAGACATTAGACACC
GACATGGAAGACATCTGTGCTAATATCAAGGTAGGATCCAGATGTGAAGT
TGAACCTGGGGCAAAAAGAGGTGTTGTAAAATTTGTTGGTCAGGCAGAAC
CACTGGGTCCTGGCTTCTGGGTTGGAGTTCAATATGATGAACCCTTGGGC
AAACATGATGGCATGTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: Cellular Component
TermDefinition
GO:0005886plasma membrane
GO:0005575cellular_component
GO:0016020membrane
GO:0005623cell
GO:0044464cell part
GO:0071944cell periphery
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Biological Process
TermDefinition
GO:0007275multicellular organismal development
GO:0009653anatomical structure morphogenesis
GO:0007349cellularization
GO:0008150biological_process
GO:0048646anatomical structure formation involved in morphogenesis
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048856anatomical structure development