Overview
NameMedtr0004s0250.1
Unique NameMedtr0004s0250.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length345
Homology
BLAST of Medtr0004s0250.1 vs. NCBI nr
Match: gi|63108985|gb|AAY33663.1| (unknown [Brassica juncea])
BLAST of Medtr0004s0250.1 vs. NCBI nr
Match: gi|62734556|gb|AAX96665.1| (transposon protein, putative, ping/pong/SNOOPY sub-class [Oryza sativa Japonica Group] >gi|108864191|gb|ABA92302.2| transposon protein, putative, Pong sub-class [Oryza sativa Japonica Group])
BLAST of Medtr0004s0250.1 vs. NCBI nr
Match: gi|115485313|ref|NP_001067800.1| (Os11g0433800 [Oryza sativa Japonica Group] >gi|62734291|gb|AAX96400.1| transposon protein, putative, ping/pong/SNOOPY sub-class [Oryza sativa Japonica Group] >gi|77550333|gb|ABA93130.1| transposon protein, putative, Pong sub-class, expressed [Oryza sativa Japonica Group] >gi|113645022|dbj|BAF28163.1| Os11g0433800 [Oryza sativa Japonica Group])
BLAST of Medtr0004s0250.1 vs. NCBI nr
Match: gi|62734663|gb|AAX96772.1| (transposon protein, putative, ping/pong/SNOOPY sub-class [Oryza sativa Japonica Group])
BLAST of Medtr0004s0250.1 vs. NCBI nr
Match: gi|242046946|ref|XP_002461219.1| (hypothetical protein SORBIDRAFT_02g043110 [Sorghum bicolor] >gi|241924596|gb|EER97740.1| hypothetical protein SORBIDRAFT_02g043110 [Sorghum bicolor])
BLAST of Medtr0004s0250.1 vs. NCBI nr
Match: gi|242067561|ref|XP_002449057.1| (hypothetical protein SORBIDRAFT_05g004203 [Sorghum bicolor] >gi|241934900|gb|EES08045.1| hypothetical protein SORBIDRAFT_05g004203 [Sorghum bicolor])
BLAST of Medtr0004s0250.1 vs. NCBI nr
Match: gi|157117225|ref|XP_001652996.1| (hypothetical protein AaeL_AAEL007906 [Aedes aegypti] >gi|108876140|gb|EAT40365.1| AAEL007906-PA [Aedes aegypti])
BLAST of Medtr0004s0250.1 vs. NCBI nr
Match: gi|242034193|ref|XP_002464491.1| (hypothetical protein SORBIDRAFT_01g019360 [Sorghum bicolor] >gi|241918345|gb|EER91489.1| hypothetical protein SORBIDRAFT_01g019360 [Sorghum bicolor])
BLAST of Medtr0004s0250.1 vs. NCBI nr
Match: gi|242043274|ref|XP_002459508.1| (hypothetical protein SORBIDRAFT_02g005830 [Sorghum bicolor] >gi|241922885|gb|EER96029.1| hypothetical protein SORBIDRAFT_02g005830 [Sorghum bicolor])
BLAST of Medtr0004s0250.1 vs. NCBI nr
Match: gi|125524879|gb|EAY72993.1| (hypothetical protein OsI_00866 [Oryza sativa Indica Group])
The following BLAST results are available for this feature:
BLAST of Medtr0004s0250.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|63108985|gb|AAY33663.1|1.625040e-3464.55unknown [Brassica juncea][more]
gi|62734556|gb|AAX96665.1|1.327260e-1349.23transposon protein, putative, ping/pong/SNOOPY sub... [more]
gi|115485313|ref|NP_001067800.1|2.223870e-1333.33Os11g0433800 [Oryza sativa Japonica Group] >gi|627... [more]
gi|62734663|gb|AAX96772.1|2.838200e-1349.23transposon protein, putative, ping/pong/SNOOPY sub... [more]
gi|242046946|ref|XP_002461219.1|9.105480e-1337.14hypothetical protein SORBIDRAFT_02g043110 [Sorghum... [more]
gi|242067561|ref|XP_002449057.1|1.445810e-1241.11hypothetical protein SORBIDRAFT_05g004203 [Sorghum... [more]
gi|157117225|ref|XP_001652996.1|1.449820e-1247.69hypothetical protein AaeL_AAEL007906 [Aedes aegypt... [more]
gi|242034193|ref|XP_002464491.1|1.679830e-1239.08hypothetical protein SORBIDRAFT_01g019360 [Sorghum... [more]
gi|242043274|ref|XP_002459508.1|1.332360e-1137.93hypothetical protein SORBIDRAFT_02g005830 [Sorghum... [more]
gi|125524879|gb|EAY72993.1|1.811820e-1138.95hypothetical protein OsI_00866 [Oryza sativa Indic... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0004s0250.1 ID=Medtr0004s0250.1|Name=Medtr0004s0250.1|organism=Medicago truncatula|type=mRNA|length=345bp
ATGGACCCTTTTGATATCGAAACCTACTTCCAAAAACGTGATGTTGAAGA
CACTTATATCGTCAACCGATTTATTCAGCGTCGAAAAAAATTAGAGGAAG
GTAGTGCATCTCTTACTAGAAAATATTTTAATAGAGATTATGCAGCGGCA
AACCAAAGACTAATTGACGACTACTTTGCCAATGAGCCTACATACGACGA
TGCAATGTTTCGTCGTCGGTACCTGATGCAAAAACACGTTTTCCTTCGAA
TCGTTGGAGACCTTTCAAGTAGTGATAACTACTTCACCCAACGAGTTGAT
GCAGCCAATAAAGAAGAAAATCCCACAAAATCCATCAAAATCTGA
back to top