Overview
NameMedtr0004s0240.1
Unique NameMedtr0004s0240.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1065
Homology
BLAST of Medtr0004s0240.1 vs. NCBI nr
Match: gi|502146172|ref|XP_004506335.1| (PREDICTED: putative mediator of RNA polymerase II transcription subunit 26-like [Cicer arietinum])
BLAST of Medtr0004s0240.1 vs. NCBI nr
Match: gi|356543108|ref|XP_003540005.1| (PREDICTED: putative mediator of RNA polymerase II transcription subunit 26-like [Glycine max])
BLAST of Medtr0004s0240.1 vs. NCBI nr
Match: gi|356531595|ref|XP_003534362.1| (PREDICTED: probable basic-leucine zipper transcription factor Q-like [Glycine max])
BLAST of Medtr0004s0240.1 vs. NCBI nr
Match: gi|225454641|ref|XP_002267090.1| (PREDICTED: uncharacterized protein LOC100249418 [Vitis vinifera])
BLAST of Medtr0004s0240.1 vs. NCBI nr
Match: gi|388505502|gb|AFK40817.1| (unknown [Lotus japonicus])
BLAST of Medtr0004s0240.1 vs. NCBI nr
Match: gi|590639585|ref|XP_007029712.1| (Uncharacterized protein TCM_025568 [Theobroma cacao] >gi|508718317|gb|EOY10214.1| Uncharacterized protein TCM_025568 [Theobroma cacao])
BLAST of Medtr0004s0240.1 vs. NCBI nr
Match: gi|297737238|emb|CBI26439.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0004s0240.1 vs. NCBI nr
Match: gi|470144373|ref|XP_004307832.1| (PREDICTED: uncharacterized protein LOC101311912 [Fragaria vesca subsp. vesca])
BLAST of Medtr0004s0240.1 vs. NCBI nr
Match: gi|255566124|ref|XP_002524050.1| (conserved hypothetical protein [Ricinus communis] >gi|223536777|gb|EEF38418.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0004s0240.1 vs. NCBI nr
Match: gi|449444641|ref|XP_004140082.1| (PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein LOC101220036 [Cucumis sativus])
The following BLAST results are available for this feature:
BLAST of Medtr0004s0240.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502146172|ref|XP_004506335.1|0.000000e+084.62PREDICTED: putative mediator of RNA polymerase II ... [more]
gi|356543108|ref|XP_003540005.1|0.000000e+085.40PREDICTED: putative mediator of RNA polymerase II ... [more]
gi|356531595|ref|XP_003534362.1|4.847410e-17480.92PREDICTED: probable basic-leucine zipper transcrip... [more]
gi|225454641|ref|XP_002267090.1|3.988180e-15674.60PREDICTED: uncharacterized protein LOC100249418 [V... [more]
gi|388505502|gb|AFK40817.1|2.933530e-15186.56unknown [Lotus japonicus][more]
gi|590639585|ref|XP_007029712.1|1.850840e-14873.78Uncharacterized protein TCM_025568 [Theobroma caca... [more]
gi|297737238|emb|CBI26439.3|1.181700e-14783.40unnamed protein product [Vitis vinifera][more]
gi|470144373|ref|XP_004307832.1|3.987210e-14271.78PREDICTED: uncharacterized protein LOC101311912 [F... [more]
gi|255566124|ref|XP_002524050.1|2.850120e-13667.45conserved hypothetical protein [Ricinus communis] ... [more]
gi|449444641|ref|XP_004140082.1|1.072570e-13465.75PREDICTED: LOW QUALITY PROTEIN: uncharacterized pr... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableCOILcoilcoiled-coilcoord: 1..30
score: NAcoord: 217..245
score
NoneNo IPR availableSEGsegsegcoord: 9..50
score: NAcoord: 67..90
score: NAcoord: 99..104
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0004s0240.1 ID=Medtr0004s0240.1|Name=Medtr0004s0240.1|organism=Medicago truncatula|type=mRNA|length=1065bp
ATGGAAGAAGCAAAGGCACTTCATCAGCAACAGCAGCAACAACAGCAACA
ACAACAACAACTATTGATTCAAGAACAACAGCGACAACAACAACAACAAC
ATTTTATGCTCTTACAGCAATTGCAAAAGCAGCAGCAACAACAACAGCAA
GCAGCTGCGATTTCTCGATTCCCATCCAACATTGACGCTCACTTGCGTCC
CATAAGACCGCCTCTCAATCTTCAACAAAACCCTAACCCTAACCCTAATT
CCAATCCCATTCTTAATTTACACCAGAACCCTAATTCAAACCACCAGCAG
CAGCAACAGCAAAAGATGATCCGACCCGGTAATCAAATGGAGCTCCAGAT
GGCTTATCAAGACGCTTGGCGGGTCTGTCACCCGGATTTCAAGCGACCCT
TTTCTTCTCTTGAAGATGCCTGCGAGAGATTATTGCCATATCATGTTGTG
GCAGATTATGAAGCCGAAGAGGATGATAGGATACTTGATTCCGACACAAC
TGGCCAGATGCTTTCAAGGTCCCAGCAGTGGGATAATAATATTGCTGCTA
AAATTGCTGAGTTTACCGCAACTTTTGAGAAGCAAGCACTTGCCTTCAAC
ATAATATCGCAAAAGAGAAGTTTGGGAGAATTTCGGTCTGAGGAGAGACT
AATGATTGAACAGGCACTTCTCCAAGAGGAAAAACGGGCACTGATCGAAT
TAAGAGCTGAATTAGAATCCAGGGAGAAGGCTGGTCGTGAAGCCCACGAG
GCTAAACTACGGATGGCAGCAATGTATCAAGCAGAGCAGCAGGCAAGGGC
TGATTCACAGTCTCATGCTGAAATGATGTCTCGAGCCCCCATAAGAGGGA
GTGCACTTGGATCCCAAGGGAGTGATATTGGGATTGTTGGCCATGACATG
GGAGATCAGGATCACGGTGAGATGATGAATGGATGGGGAAACAATGCACA
GAGAGATGAGAAGGAGCCATCTGAGGATTTCTTGAACGACGAAGCTGAAA
ATGGTGACACTGGCACGCCCGATGGCTGGCGTGAGGTTGGTGAATTTGAT
TTGAATGCTAGATGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated