Overview
NameMedtr0003s0650.1
Unique NameMedtr0003s0650.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1035
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0009790 embryo development
biological_process GO:0009792 embryo development ending in birth or egg hatching
biological_process GO:0001700 embryonic development via the syncytial blastoderm
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0005622 intracellular
cellular_component GO:0044424 intracellular part
molecular_function GO:0005488 binding
molecular_function GO:0003824 catalytic activity
molecular_function GO:0008047 enzyme activator activity
molecular_function GO:0019899 enzyme binding
molecular_function GO:0030234 enzyme regulator activity
molecular_function GO:0019209 kinase activator activity
molecular_function GO:0016301 kinase activity
molecular_function GO:0019900 kinase binding
molecular_function GO:0019207 kinase regulator activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0016773 phosphotransferase activity, alcohol group as acceptor
molecular_function GO:0005515 protein binding
molecular_function GO:0030295 protein kinase activator activity
molecular_function GO:0004672 protein kinase activity
molecular_function GO:0019887 protein kinase regulator activity
molecular_function GO:0004674 protein serine/threonine kinase activity
molecular_function GO:0016740 transferase activity
molecular_function GO:0016772 transferase activity, transferring phosphorus-containing groups
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF08569.6360278-3592685-3415-332308.53.3e-96308.73.8e-92

Homology
BLAST of Medtr0003s0650.1 vs. NCBI nr
Match: gi|502078924|ref|XP_004486097.1| (PREDICTED: calcium-binding protein 39-like [Cicer arietinum])
BLAST of Medtr0003s0650.1 vs. NCBI nr
Match: gi|359806928|ref|NP_001241580.1| (uncharacterized protein LOC100815605 [Glycine max] >gi|255645011|gb|ACU23005.1| unknown [Glycine max])
BLAST of Medtr0003s0650.1 vs. NCBI nr
Match: gi|388494586|gb|AFK35359.1| (unknown [Lotus japonicus])
BLAST of Medtr0003s0650.1 vs. NCBI nr
Match: gi|596158794|ref|XP_007222854.1| (hypothetical protein PRUPE_ppa008818mg [Prunus persica] >gi|462419790|gb|EMJ24053.1| hypothetical protein PRUPE_ppa008818mg [Prunus persica])
BLAST of Medtr0003s0650.1 vs. NCBI nr
Match: gi|590660287|ref|XP_007035360.1| (Mo25 family protein isoform 1 [Theobroma cacao] >gi|508714389|gb|EOY06286.1| Mo25 family protein isoform 1 [Theobroma cacao])
BLAST of Medtr0003s0650.1 vs. NCBI nr
Match: gi|224110494|ref|XP_002315537.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0003s0650.1 vs. NCBI nr
Match: gi|110735671|dbj|BAE99816.1| (hypothetical protein [Arabidopsis thaliana])
BLAST of Medtr0003s0650.1 vs. NCBI nr
Match: gi|18419772|ref|NP_568368.1| (Mo25-like protein [Arabidopsis thaliana] >gi|21593944|gb|AAM65898.1| unknown [Arabidopsis thaliana] >gi|124301170|gb|ABN04837.1| At5g18940 [Arabidopsis thaliana] >gi|332005248|gb|AED92631.1| Mo25-like protein [Arabidopsis thaliana])
BLAST of Medtr0003s0650.1 vs. NCBI nr
Match: gi|565460198|ref|XP_006288098.1| (hypothetical protein CARUB_v10001329mg [Capsella rubella] >gi|482556804|gb|EOA20996.1| hypothetical protein CARUB_v10001329mg [Capsella rubella])
BLAST of Medtr0003s0650.1 vs. NCBI nr
Match: gi|145362644|ref|NP_974807.2| (Mo25-like protein [Arabidopsis thaliana] >gi|332005247|gb|AED92630.1| Mo25-like protein [Arabidopsis thaliana])
The following BLAST results are available for this feature:
BLAST of Medtr0003s0650.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502078924|ref|XP_004486097.1|1.279650e-14871.87PREDICTED: calcium-binding protein 39-like [Cicer ... [more]
gi|359806928|ref|NP_001241580.1|1.110730e-14570.34uncharacterized protein LOC100815605 [Glycine max]... [more]
gi|388494586|gb|AFK35359.1|2.062250e-13566.67unknown [Lotus japonicus][more]
gi|596158794|ref|XP_007222854.1|2.746380e-13164.00hypothetical protein PRUPE_ppa008818mg [Prunus per... [more]
gi|590660287|ref|XP_007035360.1|1.379800e-12964.91Mo25 family protein isoform 1 [Theobroma cacao] >g... [more]
gi|224110494|ref|XP_002315537.1|7.228090e-12863.30predicted protein [Populus trichocarpa][more]
gi|110735671|dbj|BAE99816.1|2.611500e-12661.86hypothetical protein [Arabidopsis thaliana][more]
gi|18419772|ref|NP_568368.1|4.496790e-12661.86Mo25-like protein [Arabidopsis thaliana] >gi|21593... [more]
gi|565460198|ref|XP_006288098.1|9.622910e-12661.86hypothetical protein CARUB_v10001329mg [Capsella r... [more]
gi|145362644|ref|NP_974807.2|2.218200e-12561.26Mo25-like protein [Arabidopsis thaliana] >gi|33200... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR016024Armadillo-type foldSUPERFAMILY48371ARM repeatcoord: 7..342
score: 4.7
NoneNo IPR availableSEGsegsegcoord: 29..43
score: NAcoord: 299..320
score: NAcoord: 329..344
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0003s0650.1 ID=Medtr0003s0650.1|Name=Medtr0003s0650.1|organism=Medicago truncatula|type=mRNA|length=1035bp
ATGTCGTTCTCCTTCTATACAACGGCGCAGGAAGTGGTAGAGTCTTTGAA
AGAGAGTCTCATGGCACTGAATCCCAAAACTCATGTTGAAGATAAAGCCC
TTAAGAAAGCTTTAGAGAAAGTTGAAAAGAATTTTGGAACAATGAGAACT
ATGCTTTCTGAAAATGGAATATATTCAGAATCGCTGAATTTAGATCGAGT
TTCACAGTTTGTCGAAGAAATATGCAAGGCGGATGTTCTTACTCTTGTAA
TTCAAAAGCTGCCTATACTTGGATGGCAAGCTAGAAAGGATTTAGTACAC
TGTTGGTCAATATTTTTTAAACAAAAGGTCGTTGACACCAACGATTATTC
GTGCGTGGAATACATCGAACAACACATTGAATTACTAGACTTTCTTCTTG
TTTGCTATGATAAGAATGGAACTGCGCCGAGCTCTGGCATAATGTTGCGG
GAATGCATCAAATTTCCTAATCTTGCAAAAGGCTTATTGGAATCTCCAAG
ATTTGGGCTGTTCTTTAAATATGTAGATTTGCCTAACTTCGATGTAGCAT
ATGATGCATTTTCTACATTAAAGGAACTTCTCACTAAACATGTTAATGTG
GTCTCTGAGTATTTGAAAACTCACTGTGATGTGTTCTTTGATCTATACAA
TGAGAATCTCTTGAAGTCTCCTAATTATGCCACAAGGAGAGGGTCTATAA
ATCTTCTCTTGGATATTCTTTTGGAAACTTCAAAAGAAACTTCTGATGCT
CGGATAATGAAGCGATACATCTCACAAGTTCGTTATTTGAAAGTTGTGAT
GACATTGTTGACAGATTCAAGTAAAAAAATTCAGTTATCAGCTTTCGACA
TTTTCAAGTTTTTCGTTGCGAATCCTAATAAGCCTCGAGAAGTGAAAATT
ATTCTATGCAAGAATAAGGAAAAACTGTTAGAATTGCTTCATAAATTATC
TCTGGTAAAAGATTCAAAAGAAGATGAGCAATTTAAGGAGGAAAAGGAGT
ATATCATCAAAGAAATTGAAAGAATATCAATCTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR016024Armadillo-type fold
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005488binding
GO:0005515protein binding
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0004672protein kinase activity
GO:0004674protein serine/threonine kinase activity
GO:0008047enzyme activator activity
GO:0019887protein kinase regulator activity
GO:0016301kinase activity
GO:0016740transferase activity
GO:0016772transferase activity, transferring phosphorus-containing groups
GO:0016773phosphotransferase activity, alcohol group as acceptor
GO:0019899enzyme binding
GO:0019207kinase regulator activity
GO:0019209kinase activator activity
GO:0019900kinase binding
GO:0030234enzyme regulator activity
GO:0030295protein kinase activator activity
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0001700embryonic development via the syncytial blastoderm
GO:0007275multicellular organismal development
GO:0009790embryo development
GO:0008150biological_process
GO:0009792embryo development ending in birth or egg hatching
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048856anatomical structure development