Overview
NameMedtr0003s0620.1
Unique NameMedtr0003s0620.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length621
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0065007 biological regulation
biological_process GO:0008150 biological_process
biological_process GO:0007154 cell communication
biological_process GO:0007267 cell-cell signaling
biological_process GO:0009987 cellular process
biological_process GO:0010467 gene expression
biological_process GO:0042445 hormone metabolic process
biological_process GO:0043170 macromolecule metabolic process
biological_process GO:0008152 metabolic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0016486 peptide hormone processing
biological_process GO:0044238 primary metabolic process
biological_process GO:0051604 protein maturation
biological_process GO:0019538 protein metabolic process
biological_process GO:0016485 protein processing
biological_process GO:0065008 regulation of biological quality
biological_process GO:0010817 regulation of hormone levels
biological_process GO:0023052 signaling
biological_process GO:0044700 single organism signaling
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044699 single-organism process
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF08241.7348558-34833754-1271-7232.72.1e-1133.44.4e-08
PF13649.1348561-34835853-1201-7225.24.1e-0926.07.9e-06
PF13847.1348564-34831952-1336-9031.53e-1131.97.5e-08

Homology
BLAST of Medtr0003s0620.1 vs. NCBI nr
Match: gi|388497068|gb|AFK36600.1| (unknown [Lotus japonicus])
BLAST of Medtr0003s0620.1 vs. NCBI nr
Match: gi|502178336|ref|XP_004516228.1| (PREDICTED: methyltransferase-like protein 13-like isoform X1 [Cicer arietinum])
BLAST of Medtr0003s0620.1 vs. NCBI nr
Match: gi|356542850|ref|XP_003539878.1| (PREDICTED: methyltransferase-like protein 13-like [Glycine max])
BLAST of Medtr0003s0620.1 vs. NCBI nr
Match: gi|351726437|ref|NP_001235079.1| (uncharacterized protein LOC100527880 [Glycine max] >gi|255633450|gb|ACU17083.1| unknown [Glycine max])
BLAST of Medtr0003s0620.1 vs. NCBI nr
Match: gi|460367630|ref|XP_004229675.1| (PREDICTED: methyltransferase-like protein 13-like [Solanum lycopersicum])
BLAST of Medtr0003s0620.1 vs. NCBI nr
Match: gi|225449975|ref|XP_002272409.1| (PREDICTED: methyltransferase-like protein 13 [Vitis vinifera] >gi|296085100|emb|CBI28595.3| unnamed protein product [Vitis vinifera])
BLAST of Medtr0003s0620.1 vs. NCBI nr
Match: gi|449436703|ref|XP_004136132.1| (PREDICTED: methyltransferase-like protein 13-like [Cucumis sativus] >gi|449489144|ref|XP_004158228.1| PREDICTED: methyltransferase-like protein 13-like [Cucumis sativus])
BLAST of Medtr0003s0620.1 vs. NCBI nr
Match: gi|596055902|ref|XP_007220926.1| (hypothetical protein PRUPE_ppa023083mg, partial [Prunus persica] >gi|462417388|gb|EMJ22125.1| hypothetical protein PRUPE_ppa023083mg, partial [Prunus persica])
BLAST of Medtr0003s0620.1 vs. NCBI nr
Match: gi|590724333|ref|XP_007052437.1| (S-adenosyl-L-methionine-dependent methyltransferases superfamily protein isoform 1 [Theobroma cacao] >gi|508704698|gb|EOX96594.1| S-adenosyl-L-methionine-dependent methyltransferases superfamily protein isoform 1 [Theobroma cacao])
BLAST of Medtr0003s0620.1 vs. NCBI nr
Match: gi|224055075|ref|XP_002298412.1| (hypothetical protein POPTR_0001s26830g [Populus trichocarpa] >gi|222845670|gb|EEE83217.1| hypothetical protein POPTR_0001s26830g [Populus trichocarpa])
The following BLAST results are available for this feature:
BLAST of Medtr0003s0620.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|388497068|gb|AFK36600.1|2.512080e-10461.60unknown [Lotus japonicus][more]
gi|502178336|ref|XP_004516228.1|1.061300e-10163.22PREDICTED: methyltransferase-like protein 13-like ... [more]
gi|356542850|ref|XP_003539878.1|1.203470e-10161.35PREDICTED: methyltransferase-like protein 13-like ... [more]
gi|351726437|ref|NP_001235079.1|2.085460e-9058.92uncharacterized protein LOC100527880 [Glycine max]... [more]
gi|460367630|ref|XP_004229675.1|2.619570e-8756.96PREDICTED: methyltransferase-like protein 13-like ... [more]
gi|225449975|ref|XP_002272409.1|3.571330e-8654.37PREDICTED: methyltransferase-like protein 13 [Viti... [more]
gi|449436703|ref|XP_004136132.1|6.562060e-8652.38PREDICTED: methyltransferase-like protein 13-like ... [more]
gi|596055902|ref|XP_007220926.1|2.781380e-8456.33hypothetical protein PRUPE_ppa023083mg, partial [P... [more]
gi|590724333|ref|XP_007052437.1|5.171000e-8453.97S-adenosyl-L-methionine-dependent methyltransferas... [more]
gi|224055075|ref|XP_002298412.1|3.722200e-8152.72hypothetical protein POPTR_0001s26830g [Populus tr... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableGENE3D3.40.50.150no descriptioncoord: 11..126
score: 2
NoneNo IPR availableSUPERFAMILY53335S-adenosyl-L-methionine-dependent methyltransferasescoord: 7..125
score: 1.7

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0003s0620.1 ID=Medtr0003s0620.1|Name=Medtr0003s0620.1|organism=Medicago truncatula|type=mRNA|length=621bp
ATGTTCAGAGACGTGTCAAGTTGCAACACCTATGATTACGGTGATGCTCA
TTACTGGGACGCTCGTTACATTCAAGAGGGTGGTTCTTTTGATTGGTATC
AGCGTTACTCTAATCTTAAACCTTTTCTTCGTCACTGTTTCTCTCTTTCT
TCAACAATTCTTATGGTTGGTTGTGGCAATGCTGTTATATCGGAGGATAT
GGTCAAAGATGGTTATGAGGAAATCGTGAATATTGATATTTCATCAGTTG
CCATTGACATGATGAGAAAAAAACATGAGCGCCTCCCTCAGCTAAAATAC
TTGCAGATGGATGTTAGGGATATGAGCTTCTTTCCAGATGAATCTTTTGA
TGGTGTAATTGATAAAGCATTGATTCAGTGTTCGTGTTGTGCTCACAATC
TCTTCATCCATGCAGCAAGACCGGGATTTCATAAGCCAGAATGTAGTACT
TCATCGAAGAAATCATTGTTGGAACCTATTCCTCTTACTGACAAGGGCTT
ACTCCCAGCAGACTGGGTTATGGAAGATCCAGATTCTCACTTTATATATG
TTTGTAGAAAGGTAAATGACACAAACGGAGACGATATACCTCCATACCGA
TTAAACATTGATGTCTCATAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Biological Process
TermDefinition
GO:0008152metabolic process
GO:0007267cell-cell signaling
GO:0016485protein processing
GO:0007154cell communication
GO:0008150biological_process
GO:0009987cellular process
GO:0010467gene expression
GO:0010817regulation of hormone levels
GO:0016486peptide hormone processing
GO:0019538protein metabolic process
GO:0023052signaling
GO:0042445hormone metabolic process
GO:0043170macromolecule metabolic process
GO:0044238primary metabolic process
GO:0044699single-organism process
GO:0044700single organism signaling
GO:0044763single-organism cellular process
GO:0051604protein maturation
GO:0065007biological regulation
GO:0065008regulation of biological quality
GO:0071704organic substance metabolic process