Overview
NameMedtr0003s0480.1
Unique NameMedtr0003s0480.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length507
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0006259 DNA metabolic process
biological_process GO:0006281 DNA repair
biological_process GO:0006260 DNA replication
biological_process GO:0006261 DNA-dependent DNA replication
biological_process GO:0008150 biological_process
biological_process GO:0009058 biosynthetic process
biological_process GO:0006725 cellular aromatic compound metabolic process
biological_process GO:0044249 cellular biosynthetic process
biological_process GO:0034645 cellular macromolecule biosynthetic process
biological_process GO:0044260 cellular macromolecule metabolic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0034641 cellular nitrogen compound metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0046483 heterocycle metabolic process
biological_process GO:0009059 macromolecule biosynthetic process
biological_process GO:0043170 macromolecule metabolic process
biological_process GO:0008152 metabolic process
biological_process GO:0006807 nitrogen compound metabolic process
biological_process GO:0090304 nucleic acid metabolic process
biological_process GO:0006139 nucleobase-containing compound metabolic process
biological_process GO:1901360 organic cyclic compound metabolic process
biological_process GO:1901576 organic substance biosynthetic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0044238 primary metabolic process
cellular_component GO:0005622 intracellular
molecular_function GO:0003824 catalytic activity
molecular_function GO:0004519 endonuclease activity
molecular_function GO:0016894 endonuclease activity, active with either ribo- or deoxyribonucleic acids and producing 3'-phosphomonoesters
molecular_function GO:0016787 hydrolase activity
molecular_function GO:0016788 hydrolase activity, acting on ester bonds
molecular_function GO:0003674 molecular_function
molecular_function GO:0004518 nuclease activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01541.19241292-24151941-1161-7640.61.6e-1441.31.3e-10

Homology
BLAST of Medtr0003s0480.1 vs. NCBI nr
Match: gi|502179662|ref|XP_004516472.1| (PREDICTED: structure-specific endonuclease subunit slx1-like [Cicer arietinum])
BLAST of Medtr0003s0480.1 vs. NCBI nr
Match: gi|356529850|ref|XP_003533500.1| (PREDICTED: structure-specific endonuclease subunit slx1-like [Glycine max])
BLAST of Medtr0003s0480.1 vs. NCBI nr
Match: gi|470134499|ref|XP_004303087.1| (PREDICTED: structure-specific endonuclease subunit slx1-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0003s0480.1 vs. NCBI nr
Match: gi|596023582|ref|XP_007219127.1| (hypothetical protein PRUPE_ppa015867mg [Prunus persica] >gi|462415589|gb|EMJ20326.1| hypothetical protein PRUPE_ppa015867mg [Prunus persica])
BLAST of Medtr0003s0480.1 vs. NCBI nr
Match: gi|590724297|ref|XP_007052427.1| (LRR and NB-ARC domains-containing disease resistance protein, putative isoform 1 [Theobroma cacao] >gi|508704688|gb|EOX96584.1| LRR and NB-ARC domains-containing disease resistance protein, putative isoform 1 [Theobroma cacao])
BLAST of Medtr0003s0480.1 vs. NCBI nr
Match: gi|224054920|ref|XP_002298387.1| (hypothetical protein POPTR_0001s26700g [Populus trichocarpa] >gi|222845645|gb|EEE83192.1| hypothetical protein POPTR_0001s26700g [Populus trichocarpa])
BLAST of Medtr0003s0480.1 vs. NCBI nr
Match: gi|224054938|ref|XP_002298390.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0003s0480.1 vs. NCBI nr
Match: gi|224055063|ref|XP_002298410.1| (hypothetical protein POPTR_0001s26780g [Populus trichocarpa] >gi|222845668|gb|EEE83215.1| hypothetical protein POPTR_0001s26780g [Populus trichocarpa])
BLAST of Medtr0003s0480.1 vs. NCBI nr
Match: gi|449467603|ref|XP_004151512.1| (PREDICTED: structure-specific endonuclease subunit SLX1-like [Cucumis sativus])
BLAST of Medtr0003s0480.1 vs. NCBI nr
Match: gi|225449967|ref|XP_002271242.1| (PREDICTED: structure-specific endonuclease subunit slx1 [Vitis vinifera] >gi|296085104|emb|CBI28599.3| unnamed protein product [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0003s0480.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502179662|ref|XP_004516472.1|3.716010e-8578.70PREDICTED: structure-specific endonuclease subunit... [more]
gi|356529850|ref|XP_003533500.1|3.681120e-8273.30PREDICTED: structure-specific endonuclease subunit... [more]
gi|470134499|ref|XP_004303087.1|9.733210e-6563.28PREDICTED: structure-specific endonuclease subunit... [more]
gi|596023582|ref|XP_007219127.1|2.890200e-6363.43hypothetical protein PRUPE_ppa015867mg [Prunus per... [more]
gi|590724297|ref|XP_007052427.1|1.936460e-6165.06LRR and NB-ARC domains-containing disease resistan... [more]
gi|224054920|ref|XP_002298387.1|7.298440e-5870.40hypothetical protein POPTR_0001s26700g [Populus tr... [more]
gi|224054938|ref|XP_002298390.1|1.460040e-5770.40predicted protein [Populus trichocarpa][more]
gi|224055063|ref|XP_002298410.1|9.027800e-5771.20hypothetical protein POPTR_0001s26780g [Populus tr... [more]
gi|449467603|ref|XP_004151512.1|2.349340e-5656.40PREDICTED: structure-specific endonuclease subunit... [more]
gi|225449967|ref|XP_002271242.1|3.424050e-5659.28PREDICTED: structure-specific endonuclease subunit... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000305Excinuclease ABC, C subunit, N-terminalSUPERFAMILY82771GIY-YIG endonucleasecoord: 40..117
score: 1.9
NoneNo IPR availableSEGsegsegcoord: 19..41
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0003s0480.1 ID=Medtr0003s0480.1|Name=Medtr0003s0480.1|organism=Medicago truncatula|type=mRNA|length=507bp
ATGAGAACGCTATCTCAGACATTTCGCTCCATCAAACGCCCAATTTCAAA
CCCTAAATTATCCAAATGTTCTTCATCATCGCCTAAAAAATCAGAATTAA
AACCAAAATCAGAATCATCATCATGGTGTGTTTATCTCATTCTCTCCACC
AATCATCCAATCAAAACCTACGTTGGCGTCACTACCAATTTCCCTCGCCG
TTTGAAGGAGCATAACGGTGATCTTAAAGGTGGTGCAAAAGCTTCACGTG
CTGGAAGGCCGTGGATTTGTGCATGTATCGTTTGTGGCTTTACAAACCGA
AGTGAAGCTTGTGTATTTGAATCAAAATGGAAAGCGTTGTCAAGGAGAGT
TCCCCGCAAAAAACAAAATGACGATTCCTCCAAGCAAAGCGAAAGCGAAG
ATCCATCACGTCCACTGCTGCAACACAGGCAAGCAGCTTTAAATAGAGTG
AAAACCTCACTTGACTGCACAAACTTAGAAATTAATTGGCATTTGGATCC
AATTTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000305Excinuclease ABC, C subunit, N-terminal
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0004518nuclease activity
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0004519endonuclease activity
GO:0016787hydrolase activity
GO:0016788hydrolase activity, acting on ester bonds
GO:0016894endonuclease activity, active with either ribo- or deoxyribonucleic acids and producing 3'-phosphomonoesters
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
Vocabulary: Biological Process
TermDefinition
GO:0006281DNA repair
GO:0006260DNA replication
GO:0008152metabolic process
GO:0006139nucleobase-containing compound metabolic process
GO:0006259DNA metabolic process
GO:0006261DNA-dependent DNA replication
GO:0006725cellular aromatic compound metabolic process
GO:0006807nitrogen compound metabolic process
GO:0008150biological_process
GO:0009058biosynthetic process
GO:0009059macromolecule biosynthetic process
GO:0009987cellular process
GO:0034641cellular nitrogen compound metabolic process
GO:0034645cellular macromolecule biosynthetic process
GO:0043170macromolecule metabolic process
GO:0044237cellular metabolic process
GO:0044238primary metabolic process
GO:0044249cellular biosynthetic process
GO:0044260cellular macromolecule metabolic process
GO:0046483heterocycle metabolic process
GO:0071704organic substance metabolic process
GO:0090304nucleic acid metabolic process
GO:1901360organic cyclic compound metabolic process
GO:1901576organic substance biosynthetic process