Overview
NameMedtr0003s0470.1
Unique NameMedtr0003s0470.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1248
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:1901264 carbohydrate derivative transport
biological_process GO:0008283 cell proliferation
biological_process GO:0006725 cellular aromatic compound metabolic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0034641 cellular nitrogen compound metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0051234 establishment of localization
biological_process GO:0046483 heterocycle metabolic process
biological_process GO:0051179 localization
biological_process GO:0008152 metabolic process
biological_process GO:0006807 nitrogen compound metabolic process
biological_process GO:0071705 nitrogen compound transport
biological_process GO:0006139 nucleobase-containing compound metabolic process
biological_process GO:0015931 nucleobase-containing compound transport
biological_process GO:1901642 nucleoside transmembrane transport
biological_process GO:0015858 nucleoside transport
biological_process GO:1901360 organic cyclic compound metabolic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0071702 organic substance transport
biological_process GO:0044238 primary metabolic process
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044699 single-organism process
biological_process GO:0044765 single-organism transport
biological_process GO:0055085 transmembrane transport
biological_process GO:0006810 transport
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0071944 cell periphery
cellular_component GO:0005575 cellular_component
cellular_component GO:0016020 membrane
cellular_component GO:0005886 plasma membrane
molecular_function GO:1901505 carbohydrate derivative transporter activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0015932 nucleobase-containing compound transmembrane transporter activity
molecular_function GO:0005337 nucleoside transmembrane transporter activity
molecular_function GO:0022891 substrate-specific transmembrane transporter activity
molecular_function GO:0022892 substrate-specific transporter activity
molecular_function GO:0022857 transmembrane transporter activity
molecular_function GO:0005215 transporter activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01733.13237247-236414137-4144-307241.95.7e-76245.56.6e-73

Homology
BLAST of Medtr0003s0470.1 vs. NCBI nr
Match: gi|502179666|ref|XP_004516473.1| (PREDICTED: equilibrative nucleotide transporter 1-like [Cicer arietinum])
BLAST of Medtr0003s0470.1 vs. NCBI nr
Match: gi|356542879|ref|XP_003539892.1| (PREDICTED: equilibrative nucleotide transporter 1-like [Glycine max])
BLAST of Medtr0003s0470.1 vs. NCBI nr
Match: gi|356531627|ref|XP_003534378.1| (PREDICTED: equilibrative nucleotide transporter 1-like [Glycine max])
BLAST of Medtr0003s0470.1 vs. NCBI nr
Match: gi|596142533|ref|XP_007222552.1| (hypothetical protein PRUPE_ppa006225mg [Prunus persica] >gi|462419488|gb|EMJ23751.1| hypothetical protein PRUPE_ppa006225mg [Prunus persica])
BLAST of Medtr0003s0470.1 vs. NCBI nr
Match: gi|225424683|ref|XP_002263287.1| (PREDICTED: equilibrative nucleoside transporter 4-like [Vitis vinifera])
BLAST of Medtr0003s0470.1 vs. NCBI nr
Match: gi|590694205|ref|XP_007044544.1| (Nucleoside transporter, putative [Theobroma cacao] >gi|508708479|gb|EOY00376.1| Nucleoside transporter, putative [Theobroma cacao])
BLAST of Medtr0003s0470.1 vs. NCBI nr
Match: gi|470123244|ref|XP_004297638.1| (PREDICTED: equilibrative nucleotide transporter 1-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0003s0470.1 vs. NCBI nr
Match: gi|255568754|ref|XP_002525348.1| (nucleoside transporter, putative [Ricinus communis] >gi|223535311|gb|EEF36986.1| nucleoside transporter, putative [Ricinus communis])
BLAST of Medtr0003s0470.1 vs. NCBI nr
Match: gi|255568752|ref|XP_002525347.1| (nucleoside transporter, putative [Ricinus communis] >gi|223535310|gb|EEF36985.1| nucleoside transporter, putative [Ricinus communis])
BLAST of Medtr0003s0470.1 vs. NCBI nr
Match: gi|118480977|gb|ABK92442.1| (unknown [Populus trichocarpa])
The following BLAST results are available for this feature:
BLAST of Medtr0003s0470.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502179666|ref|XP_004516473.1|0.000000e+091.08PREDICTED: equilibrative nucleotide transporter 1-... [more]
gi|356542879|ref|XP_003539892.1|0.000000e+079.51PREDICTED: equilibrative nucleotide transporter 1-... [more]
gi|356531627|ref|XP_003534378.1|0.000000e+081.01PREDICTED: equilibrative nucleotide transporter 1-... [more]
gi|596142533|ref|XP_007222552.1|0.000000e+073.54hypothetical protein PRUPE_ppa006225mg [Prunus per... [more]
gi|225424683|ref|XP_002263287.1|0.000000e+072.33PREDICTED: equilibrative nucleoside transporter 4-... [more]
gi|590694205|ref|XP_007044544.1|0.000000e+071.87Nucleoside transporter, putative [Theobroma cacao]... [more]
gi|470123244|ref|XP_004297638.1|0.000000e+071.19PREDICTED: equilibrative nucleotide transporter 1-... [more]
gi|255568754|ref|XP_002525348.1|0.000000e+072.66nucleoside transporter, putative [Ricinus communis... [more]
gi|255568752|ref|XP_002525347.1|0.000000e+068.61nucleoside transporter, putative [Ricinus communis... [more]
gi|118480977|gb|ABK92442.1|0.000000e+070.05unknown [Populus trichocarpa][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR002259Delayed-early response protein/equilibrative nucleoside transporterPRINTSPR01130DERENTRNSPRTcoord: 135..155
score: 5.4e-06coord: 354..370
score: 5.4e-06coord: 373..389
score: 5.4e-06coord: 391..415
score: 5.4
IPR002259Delayed-early response protein/equilibrative nucleoside transporterTIGRFAMsTIGR009392a57: Nucleoside Transportercoord: 36..415
score: 8.4e
NoneNo IPR availableSEGsegsegcoord: 4..21
score: NAcoord: 100..114
score: NAcoord: 117..147
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0003s0470.1 ID=Medtr0003s0470.1|Name=Medtr0003s0470.1|organism=Medicago truncatula|type=mRNA|length=1248bp
ATGGTATTCACCGATTCCGATTCAACTCTTCTTTTACCATCATCATCATC
TTCAGAAACAACCAAAAAAGCACCACAAGACAAATACCATTTAGCATACA
TAACCTATTTCATCCTCGGTTTCGGTTATTTACTTCCATGGAATGCATTC
ATCACAGCCGTTGATTATTTCTCTTATCTTTACCCTGAAGCAAGCGTTGA
TCGCATCTTCGCCGTTGTTTACATGCTCGTTGGTCTCTTTGGTCTTACTG
TGATTATTCTTTATAGGCATAAATCTCATGCTTATGTTAGGATTAACTTG
GGTCTTGCTCTTTTTGTTGTTTCGTTGCTGCTTGTTCCTTTGATTGATGT
TTTTTATGTTAAGGGTCGGGTCGGGTTTTACGGTGGGTTTTATGTTGCTG
TTGGTGCTGTTGGACTTTCGGGTGTTGCTGATGCATTGGTGCAGGGTTCA
ATTGTTGGATCTGCTGGTGAGTTGCCGGAGAGGTATATGCAAGCTGTCAT
TGCTGGCACTGCTGCTTCTGGGGTACTTGTTTCTTTCCTGAGAATATTTA
CAAAAGCTGTTTACACACAAGATGTCTCCGGTCTGCAAAAGAGTGCAAAT
CTCTACTTTGCGGTATCAATTGTGATTATGTTCCTATGCATGGTTTTGTA
CAATGTAGCTCACAAACTTCCCATTATGAAGTACTACGATGAACTAAAGA
TTCAGGCAGTCGCTGTGGAAGACGACAACAGTCCTTTGACTGGATCTGTT
TGGAGATCAACTGTATGGGATACCGTGGGAACAATCAAGTGGTATGGAGT
TGCATTAATGCTCATTTATGTTGTGACACTCGCAATATTTCCAGGTTACA
TTACAGAGGATGTCCACTCTCAACTTCTTAAGGATTGGTATCCAGTTCTC
CTTATTACTTGCTTTAATGTTTTTGACCTAGTCGGCAAAAGCCTTACCGC
AGTATACCTTCTAGAGAATGCAAAAATTGCTATTGGTTGTTGCATAGCAA
GACTGTTGTTTTTCCCTCTCTTCTTGGGATGCCTACATGGTCCAAAATTC
TTCCGGACAGAGATTCCTGTCACAATACTGACTTGTCTCTTGGGGCTTAC
AAATGGATACCTTACCAGTGTATTGATGATTTTAGCTCCTAAAACCGTAA
AGTTACAGCATGCCGAGACTGCCGGGATTGTGAGTGTGTTATTCTTAGTT
TTCGGTCTGGCTTCTGGTTCTATTATTGCTTGGTTTTGGGTCATCTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR002259Delayed-early response protein/equilibrative nucleoside transporter
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005337nucleoside transmembrane transporter activity
GO:0003674molecular_function
GO:0005215transporter activity
GO:0022857transmembrane transporter activity
GO:0015932nucleobase-containing compound transmembrane transporter activity
GO:0022891substrate-specific transmembrane transporter activity
GO:0022892substrate-specific transporter activity
GO:1901505carbohydrate derivative transporter activity
Vocabulary: Biological Process
TermDefinition
GO:0006810transport
GO:0008152metabolic process
GO:0006139nucleobase-containing compound metabolic process
GO:0006725cellular aromatic compound metabolic process
GO:0006807nitrogen compound metabolic process
GO:0008150biological_process
GO:0008283cell proliferation
GO:0009987cellular process
GO:0015858nucleoside transport
GO:0015931nucleobase-containing compound transport
GO:0034641cellular nitrogen compound metabolic process
GO:0044237cellular metabolic process
GO:0044238primary metabolic process
GO:0044699single-organism process
GO:0044763single-organism cellular process
GO:0044765single-organism transport
GO:0046483heterocycle metabolic process
GO:0051179localization
GO:0051234establishment of localization
GO:0055085transmembrane transport
GO:0071702organic substance transport
GO:0071704organic substance metabolic process
GO:0071705nitrogen compound transport
GO:1901264carbohydrate derivative transport
GO:1901360organic cyclic compound metabolic process
GO:1901642nucleoside transmembrane transport
Vocabulary: Cellular Component
TermDefinition
GO:0016020membrane
GO:0005886plasma membrane
GO:0005575cellular_component
GO:0005623cell
GO:0044464cell part
GO:0071944cell periphery