Overview
NameMedtr0003s0250.1
Unique NameMedtr0003s0250.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length645
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0006200 ATP catabolic process
biological_process GO:0046034 ATP metabolic process
biological_process GO:0071103 DNA conformation change
biological_process GO:0032508 DNA duplex unwinding
biological_process GO:0032392 DNA geometric change
biological_process GO:0006259 DNA metabolic process
biological_process GO:0006260 DNA replication
biological_process GO:0060249 anatomical structure homeostasis
biological_process GO:0019439 aromatic compound catabolic process
biological_process GO:0065007 biological regulation
biological_process GO:0008150 biological_process
biological_process GO:0009058 biosynthetic process
biological_process GO:1901136 carbohydrate derivative catabolic process
biological_process GO:1901135 carbohydrate derivative metabolic process
biological_process GO:0009056 catabolic process
biological_process GO:0006725 cellular aromatic compound metabolic process
biological_process GO:0044249 cellular biosynthetic process
biological_process GO:0044248 cellular catabolic process
biological_process GO:0016043 cellular component organization
biological_process GO:0071840 cellular component organization or biogenesis
biological_process GO:0034645 cellular macromolecule biosynthetic process
biological_process GO:0044260 cellular macromolecule metabolic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0044270 cellular nitrogen compound catabolic process
biological_process GO:0034641 cellular nitrogen compound metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0051276 chromosome organization
biological_process GO:1901658 glycosyl compound catabolic process
biological_process GO:1901657 glycosyl compound metabolic process
biological_process GO:0046700 heterocycle catabolic process
biological_process GO:0046483 heterocycle metabolic process
biological_process GO:0042592 homeostatic process
biological_process GO:0009059 macromolecule biosynthetic process
biological_process GO:0043170 macromolecule metabolic process
biological_process GO:0008152 metabolic process
biological_process GO:0043086 negative regulation of catalytic activity
biological_process GO:0044092 negative regulation of molecular function
biological_process GO:0051974 negative regulation of telomerase activity
biological_process GO:0051348 negative regulation of transferase activity
biological_process GO:0006807 nitrogen compound metabolic process
biological_process GO:0090304 nucleic acid metabolic process
biological_process GO:0034655 nucleobase-containing compound catabolic process
biological_process GO:0006139 nucleobase-containing compound metabolic process
biological_process GO:0055086 nucleobase-containing small molecule metabolic process
biological_process GO:0009164 nucleoside catabolic process
biological_process GO:0009116 nucleoside metabolic process
biological_process GO:0009125 nucleoside monophosphate catabolic process
biological_process GO:0009123 nucleoside monophosphate metabolic process
biological_process GO:1901292 nucleoside phosphate catabolic process
biological_process GO:0006753 nucleoside phosphate metabolic process
biological_process GO:0009143 nucleoside triphosphate catabolic process
biological_process GO:0009141 nucleoside triphosphate metabolic process
biological_process GO:0009166 nucleotide catabolic process
biological_process GO:0009117 nucleotide metabolic process
biological_process GO:0006996 organelle organization
biological_process GO:1901361 organic cyclic compound catabolic process
biological_process GO:1901360 organic cyclic compound metabolic process
biological_process GO:1901576 organic substance biosynthetic process
biological_process GO:1901575 organic substance catabolic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:1901565 organonitrogen compound catabolic process
biological_process GO:1901564 organonitrogen compound metabolic process
biological_process GO:0046434 organophosphate catabolic process
biological_process GO:0019637 organophosphate metabolic process
biological_process GO:0006796 phosphate-containing compound metabolic process
biological_process GO:0006793 phosphorus metabolic process
biological_process GO:0044238 primary metabolic process
biological_process GO:0006152 purine nucleoside catabolic process
biological_process GO:0042278 purine nucleoside metabolic process
biological_process GO:0009128 purine nucleoside monophosphate catabolic process
biological_process GO:0009126 purine nucleoside monophosphate metabolic process
biological_process GO:0009146 purine nucleoside triphosphate catabolic process
biological_process GO:0009144 purine nucleoside triphosphate metabolic process
biological_process GO:0006195 purine nucleotide catabolic process
biological_process GO:0006163 purine nucleotide metabolic process
biological_process GO:0046130 purine ribonucleoside catabolic process
biological_process GO:0046128 purine ribonucleoside metabolic process
biological_process GO:0009169 purine ribonucleoside monophosphate catabolic process
biological_process GO:0009167 purine ribonucleoside monophosphate metabolic process
biological_process GO:0009207 purine ribonucleoside triphosphate catabolic process
biological_process GO:0009205 purine ribonucleoside triphosphate metabolic process
biological_process GO:0009154 purine ribonucleotide catabolic process
biological_process GO:0009150 purine ribonucleotide metabolic process
biological_process GO:0072523 purine-containing compound catabolic process
biological_process GO:0072521 purine-containing compound metabolic process
biological_process GO:0051052 regulation of DNA metabolic process
biological_process GO:0006275 regulation of DNA replication
biological_process GO:0050789 regulation of biological process
biological_process GO:0065008 regulation of biological quality
biological_process GO:0009889 regulation of biosynthetic process
biological_process GO:0050790 regulation of catalytic activity
biological_process GO:0031326 regulation of cellular biosynthetic process
biological_process GO:0051128 regulation of cellular component organization
biological_process GO:2000112 regulation of cellular macromolecule biosynthetic process
biological_process GO:0031323 regulation of cellular metabolic process
biological_process GO:0050794 regulation of cellular process
biological_process GO:0033044 regulation of chromosome organization
biological_process GO:0032844 regulation of homeostatic process
biological_process GO:0010556 regulation of macromolecule biosynthetic process
biological_process GO:0060255 regulation of macromolecule metabolic process
biological_process GO:0019222 regulation of metabolic process
biological_process GO:0065009 regulation of molecular function
biological_process GO:0051171 regulation of nitrogen compound metabolic process
biological_process GO:0019219 regulation of nucleobase-containing compound metabolic process
biological_process GO:0033043 regulation of organelle organization
biological_process GO:0080090 regulation of primary metabolic process
biological_process GO:0051972 regulation of telomerase activity
biological_process GO:0032204 regulation of telomere maintenance
biological_process GO:0051338 regulation of transferase activity
biological_process GO:0042454 ribonucleoside catabolic process
biological_process GO:0009119 ribonucleoside metabolic process
biological_process GO:0009158 ribonucleoside monophosphate catabolic process
biological_process GO:0009161 ribonucleoside monophosphate metabolic process
biological_process GO:0009203 ribonucleoside triphosphate catabolic process
biological_process GO:0009199 ribonucleoside triphosphate metabolic process
biological_process GO:0009261 ribonucleotide catabolic process
biological_process GO:0009259 ribonucleotide metabolic process
biological_process GO:0019693 ribose phosphate metabolic process
biological_process GO:0044712 single-organism catabolic process
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044710 single-organism metabolic process
biological_process GO:0044699 single-organism process
biological_process GO:0044281 small molecule metabolic process
biological_process GO:0000723 telomere maintenance
biological_process GO:0032200 telomere organization
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0044427 chromosomal part
cellular_component GO:0005694 chromosome
cellular_component GO:0000781 chromosome, telomeric region
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043232 intracellular non-membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0070013 intracellular organelle lumen
cellular_component GO:0044446 intracellular organelle part
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0031974 membrane-enclosed lumen
cellular_component GO:0043228 non-membrane-bounded organelle
cellular_component GO:0000228 nuclear chromosome
cellular_component GO:0044454 nuclear chromosome part
cellular_component GO:0000784 nuclear chromosome, telomeric region
cellular_component GO:0031981 nuclear lumen
cellular_component GO:0044428 nuclear part
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
cellular_component GO:0043233 organelle lumen
cellular_component GO:0044422 organelle part
molecular_function GO:0043139 5'-3' DNA helicase activity
molecular_function GO:0033678 5'-3' DNA/RNA helicase activity
molecular_function GO:0005524 ATP binding
molecular_function GO:0043141 ATP-dependent 5'-3' DNA helicase activity
molecular_function GO:0033682 ATP-dependent 5'-3' DNA/RNA helicase activity
molecular_function GO:0004003 ATP-dependent DNA helicase activity
molecular_function GO:0033680 ATP-dependent DNA/RNA helicase activity
molecular_function GO:0008026 ATP-dependent helicase activity
molecular_function GO:0016887 ATPase activity
molecular_function GO:0042623 ATPase activity, coupled
molecular_function GO:0003677 DNA binding
molecular_function GO:0003678 DNA helicase activity
molecular_function GO:0008094 DNA-dependent ATPase activity
molecular_function GO:0033677 DNA/RNA helicase activity
molecular_function GO:0030554 adenyl nucleotide binding
molecular_function GO:0032559 adenyl ribonucleotide binding
molecular_function GO:0043168 anion binding
molecular_function GO:0005488 binding
molecular_function GO:0097367 carbohydrate derivative binding
molecular_function GO:0003824 catalytic activity
molecular_function GO:0043169 cation binding
molecular_function GO:0004386 helicase activity
molecular_function GO:1901363 heterocyclic compound binding
molecular_function GO:0016787 hydrolase activity
molecular_function GO:0016817 hydrolase activity, acting on acid anhydrides
molecular_function GO:0016818 hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides
molecular_function GO:0043167 ion binding
molecular_function GO:0000287 magnesium ion binding
molecular_function GO:0046872 metal ion binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0003676 nucleic acid binding
molecular_function GO:0001882 nucleoside binding
molecular_function GO:1901265 nucleoside phosphate binding
molecular_function GO:0017111 nucleoside-triphosphatase activity
molecular_function GO:0000166 nucleotide binding
molecular_function GO:0097159 organic cyclic compound binding
molecular_function GO:0070035 purine NTP-dependent helicase activity
molecular_function GO:0001883 purine nucleoside binding
molecular_function GO:0017076 purine nucleotide binding
molecular_function GO:0032550 purine ribonucleoside binding
molecular_function GO:0035639 purine ribonucleoside triphosphate binding
molecular_function GO:0032555 purine ribonucleotide binding
molecular_function GO:0016462 pyrophosphatase activity
molecular_function GO:0032549 ribonucleoside binding
molecular_function GO:0032553 ribonucleotide binding
molecular_function GO:0043565 sequence-specific DNA binding
molecular_function GO:0017116 single-stranded DNA-dependent ATP-dependent DNA helicase activity
molecular_function GO:0043142 single-stranded DNA-dependent ATPase activity
molecular_function GO:0036094 small molecule binding
molecular_function GO:0042162 telomeric DNA binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF05970.9123130-1227381-131234-364137.53.3e-44137.83.8e-40

Homology
BLAST of Medtr0003s0250.1 vs. NCBI nr
Match: gi|502114304|ref|XP_004494925.1| (PREDICTED: uncharacterized protein LOC101491220 [Cicer arietinum])
BLAST of Medtr0003s0250.1 vs. NCBI nr
Match: gi|356514097|ref|XP_003525743.1| (PREDICTED: uncharacterized protein LOC100807389 [Glycine max])
BLAST of Medtr0003s0250.1 vs. NCBI nr
Match: gi|242088309|ref|XP_002439987.1| (hypothetical protein SORBIDRAFT_09g023900 [Sorghum bicolor] >gi|241945272|gb|EES18417.1| hypothetical protein SORBIDRAFT_09g023900 [Sorghum bicolor])
BLAST of Medtr0003s0250.1 vs. NCBI nr
Match: gi|565449975|ref|XP_006285587.1| (hypothetical protein CARUB_v10007032mg [Capsella rubella] >gi|482554292|gb|EOA18485.1| hypothetical protein CARUB_v10007032mg [Capsella rubella])
BLAST of Medtr0003s0250.1 vs. NCBI nr
Match: gi|218200559|gb|EEC82986.1| (hypothetical protein OsI_28021 [Oryza sativa Indica Group])
BLAST of Medtr0003s0250.1 vs. NCBI nr
Match: gi|297727649|ref|NP_001176188.1| (Os10g0457932 [Oryza sativa Japonica Group] >gi|255679464|dbj|BAH94916.1| Os10g0457932 [Oryza sativa Japonica Group])
BLAST of Medtr0003s0250.1 vs. NCBI nr
Match: gi|14140286|gb|AAK54292.1|AC034258_10 (putative helicase [Oryza sativa Japonica Group])
BLAST of Medtr0003s0250.1 vs. NCBI nr
Match: gi|110289187|gb|ABB47755.2| (expressed protein [Oryza sativa Japonica Group])
BLAST of Medtr0003s0250.1 vs. NCBI nr
Match: gi|565428206|ref|XP_006279419.1| (hypothetical protein CARUB_v10007951mg, partial [Capsella rubella] >gi|482548118|gb|EOA12317.1| hypothetical protein CARUB_v10007951mg, partial [Capsella rubella])
BLAST of Medtr0003s0250.1 vs. NCBI nr
Match: gi|502131846|ref|XP_004501122.1| (PREDICTED: uncharacterized protein LOC101510714, partial [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0003s0250.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502114304|ref|XP_004494925.1|3.472380e-7961.62PREDICTED: uncharacterized protein LOC101491220 [C... [more]
gi|356514097|ref|XP_003525743.1|4.822740e-7156.73PREDICTED: uncharacterized protein LOC100807389 [G... [more]
gi|242088309|ref|XP_002439987.1|8.529520e-6550.24hypothetical protein SORBIDRAFT_09g023900 [Sorghum... [more]
gi|565449975|ref|XP_006285587.1|2.776690e-6046.15hypothetical protein CARUB_v10007032mg [Capsella r... [more]
gi|218200559|gb|EEC82986.1|2.897190e-5743.87hypothetical protein OsI_28021 [Oryza sativa Indic... [more]
gi|297727649|ref|NP_001176188.1|3.269510e-5745.32Os10g0457932 [Oryza sativa Japonica Group] >gi|255... [more]
gi|14140286|gb|AAK54292.1|AC034258_101.106970e-5545.10putative helicase [Oryza sativa Japonica Group][more]
gi|110289187|gb|ABB47755.2|1.115950e-5545.10expressed protein [Oryza sativa Japonica Group][more]
gi|565428206|ref|XP_006279419.1|1.842130e-5543.54hypothetical protein CARUB_v10007951mg, partial [C... [more]
gi|502131846|ref|XP_004501122.1|3.240840e-5544.08PREDICTED: uncharacterized protein LOC101510714, p... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSUPERFAMILY52540P-loop containing nucleoside triphosphate hydrolasescoord: 30..198
score: 5.8

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0003s0250.1 ID=Medtr0003s0250.1|Name=Medtr0003s0250.1|organism=Medicago truncatula|type=mRNA|length=645bp
ATGCTAATAACTGAATTTGAAGATCCAATCTTAGCAATTGTTCAAAGTAC
CTATCCAAGTTTTGCAGACAATTACAAGTCTTATGAATACTTAAAATCCA
GGGCGATATTAGCATCAACTATAGAAGTTGTAGATCAAATTAACGATTAT
GTTCTCAACCTTATGTCAGGTGATGTCAGAGTCTATTACAGTTCCAATAT
TTTTGATAGATCTGAAATTCATGACAACAACATTGTTGAGGTACTAACAC
CTGAGTTCCTTAGTTCACTTTGTACATCAGGTCTTCCAAATCACAAAATC
AAACTGAAAGTTGGTGCTCCAATTATGCTCTTGAGAAATTTAGATCAGTC
TGAGGGATTGTGCAATGGAACAAGATTGATTGTTACAAAATTGACAACTC
ATGTTCTAGAAGCTAAAATTATGGGTGGTAATCATCATGGTAACATCATC
TATATTCCTCGCATGGATATGTCCCCATCACAATCTCCATGGCCATTCAA
GTTAAATAAAAGACAATTTTCAATTGTTGTCTCATACTCAATGACAATCA
ACAAATCACAAGGTCGATCCTTAGATTATGTTGGCCTCTATTTGGCAAGA
GATATTTTAGCCATGGACAAATTTATGTTGCACTTTCTAGGGTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated
Vocabulary: Biological Process
TermDefinition
GO:0006260DNA replication
GO:0051276chromosome organization
GO:0000723telomere maintenance
GO:0008152metabolic process
GO:0006139nucleobase-containing compound metabolic process
GO:0006163purine nucleotide metabolic process
GO:0042278purine nucleoside metabolic process
GO:0006152purine nucleoside catabolic process
GO:0006195purine nucleotide catabolic process
GO:0006200ATP catabolic process
GO:0006259DNA metabolic process
GO:0006275regulation of DNA replication
GO:0006725cellular aromatic compound metabolic process
GO:0006753nucleoside phosphate metabolic process
GO:0006793phosphorus metabolic process
GO:0006796phosphate-containing compound metabolic process
GO:0006807nitrogen compound metabolic process
GO:0006996organelle organization
GO:0008150biological_process
GO:0009056catabolic process
GO:0009058biosynthetic process
GO:0009059macromolecule biosynthetic process
GO:0009116nucleoside metabolic process
GO:0009117nucleotide metabolic process
GO:0009119ribonucleoside metabolic process
GO:0009123nucleoside monophosphate metabolic process
GO:0009125nucleoside monophosphate catabolic process
GO:0009126purine nucleoside monophosphate metabolic process
GO:0009128purine nucleoside monophosphate catabolic process
GO:0009141nucleoside triphosphate metabolic process
GO:0009143nucleoside triphosphate catabolic process
GO:0009144purine nucleoside triphosphate metabolic process
GO:0009146purine nucleoside triphosphate catabolic process
GO:0009150purine ribonucleotide metabolic process
GO:0009154purine ribonucleotide catabolic process
GO:0009158ribonucleoside monophosphate catabolic process
GO:0009161ribonucleoside monophosphate metabolic process
GO:0009164nucleoside catabolic process
GO:0009166nucleotide catabolic process
GO:0009167purine ribonucleoside monophosphate metabolic process
GO:0009169purine ribonucleoside monophosphate catabolic process
GO:0009199ribonucleoside triphosphate metabolic process
GO:0009203ribonucleoside triphosphate catabolic process
GO:0009205purine ribonucleoside triphosphate metabolic process
GO:0009207purine ribonucleoside triphosphate catabolic process
GO:0009259ribonucleotide metabolic process
GO:0009261ribonucleotide catabolic process
GO:0009889regulation of biosynthetic process
GO:0009987cellular process
GO:0010556regulation of macromolecule biosynthetic process
GO:0016043cellular component organization
GO:0019219regulation of nucleobase-containing compound metabolic process
GO:0019222regulation of metabolic process
GO:0019439aromatic compound catabolic process
GO:0019637organophosphate metabolic process
GO:0019693ribose phosphate metabolic process
GO:0031323regulation of cellular metabolic process
GO:0031326regulation of cellular biosynthetic process
GO:0032200telomere organization
GO:0032204regulation of telomere maintenance
GO:0032392DNA geometric change
GO:0032508DNA duplex unwinding
GO:0032844regulation of homeostatic process
GO:0033043regulation of organelle organization
GO:0033044regulation of chromosome organization
GO:0034641cellular nitrogen compound metabolic process
GO:0034645cellular macromolecule biosynthetic process
GO:0034655nucleobase-containing compound catabolic process
GO:0042454ribonucleoside catabolic process
GO:0042592homeostatic process
GO:0043086negative regulation of catalytic activity
GO:0043170macromolecule metabolic process
GO:0044092negative regulation of molecular function
GO:0044237cellular metabolic process
GO:0044238primary metabolic process
GO:0044248cellular catabolic process
GO:0044249cellular biosynthetic process
GO:0044260cellular macromolecule metabolic process
GO:0044270cellular nitrogen compound catabolic process
GO:0044281small molecule metabolic process
GO:0044699single-organism process
GO:0044710single-organism metabolic process
GO:0044712single-organism catabolic process
GO:0044763single-organism cellular process
GO:0046034ATP metabolic process
GO:0046128purine ribonucleoside metabolic process
GO:0046130purine ribonucleoside catabolic process
GO:0046434organophosphate catabolic process
GO:0046483heterocycle metabolic process
GO:0046700heterocycle catabolic process
GO:0050789regulation of biological process
GO:0050790regulation of catalytic activity
GO:0050794regulation of cellular process
GO:0051052regulation of DNA metabolic process
GO:0051128regulation of cellular component organization
GO:0051171regulation of nitrogen compound metabolic process
GO:0051338regulation of transferase activity
GO:0051348negative regulation of transferase activity
GO:0051972regulation of telomerase activity
GO:0051974negative regulation of telomerase activity
GO:0055086nucleobase-containing small molecule metabolic process
GO:0060249anatomical structure homeostasis
GO:0060255regulation of macromolecule metabolic process
GO:0065007biological regulation
GO:0065008regulation of biological quality
GO:0065009regulation of molecular function
GO:0071103DNA conformation change
GO:0071704organic substance metabolic process
GO:0071840cellular component organization or biogenesis
GO:0072521purine-containing compound metabolic process
GO:0072523purine-containing compound catabolic process
GO:0080090regulation of primary metabolic process
GO:0090304nucleic acid metabolic process
GO:1901135carbohydrate derivative metabolic process
GO:1901136carbohydrate derivative catabolic process
GO:1901292nucleoside phosphate catabolic process
GO:1901360organic cyclic compound metabolic process
GO:1901361organic cyclic compound catabolic process
GO:1901564organonitrogen compound metabolic process
GO:1901565organonitrogen compound catabolic process
GO:1901575organic substance catabolic process
GO:1901576organic substance biosynthetic process
GO:1901657glycosyl compound metabolic process
GO:1901658glycosyl compound catabolic process
GO:2000112regulation of cellular macromolecule biosynthetic process
Vocabulary: Molecular Function
TermDefinition
GO:0000166nucleotide binding
GO:0000287magnesium ion binding
GO:0001882nucleoside binding
GO:0001883purine nucleoside binding
GO:0003674molecular_function
GO:0003676nucleic acid binding
GO:0003677DNA binding
GO:0003678DNA helicase activity
GO:0042623ATPase activity, coupled
GO:0003824catalytic activity
GO:0004003ATP-dependent DNA helicase activity
GO:0017111nucleoside-triphosphatase activity
GO:0004386helicase activity
GO:0005488binding
GO:0046872metal ion binding
GO:0005524ATP binding
GO:0042162telomeric DNA binding
GO:0008026ATP-dependent helicase activity
GO:0008094DNA-dependent ATPase activity
GO:0016887ATPase activity
GO:0016462pyrophosphatase activity
GO:0016787hydrolase activity
GO:0016817hydrolase activity, acting on acid anhydrides
GO:0016818hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides
GO:0017076purine nucleotide binding
GO:0017116single-stranded DNA-dependent ATP-dependent DNA helicase activity
GO:0030554adenyl nucleotide binding
GO:0032549ribonucleoside binding
GO:0032550purine ribonucleoside binding
GO:0032553ribonucleotide binding
GO:0032555purine ribonucleotide binding
GO:0032559adenyl ribonucleotide binding
GO:0033677DNA/RNA helicase activity
GO:00336785'-3' DNA/RNA helicase activity
GO:0033680ATP-dependent DNA/RNA helicase activity
GO:0033682ATP-dependent 5'-3' DNA/RNA helicase activity
GO:0035639purine ribonucleoside triphosphate binding
GO:0036094small molecule binding
GO:00431395'-3' DNA helicase activity
GO:0043141ATP-dependent 5'-3' DNA helicase activity
GO:0043142single-stranded DNA-dependent ATPase activity
GO:0043167ion binding
GO:0043168anion binding
GO:0043169cation binding
GO:0043565sequence-specific DNA binding
GO:0070035purine NTP-dependent helicase activity
GO:0097159organic cyclic compound binding
GO:0097367carbohydrate derivative binding
GO:1901265nucleoside phosphate binding
GO:1901363heterocyclic compound binding
Vocabulary: Cellular Component
TermDefinition
GO:0000228nuclear chromosome
GO:0005622intracellular
GO:0005575cellular_component
GO:0000781chromosome, telomeric region
GO:0000784nuclear chromosome, telomeric region
GO:0005623cell
GO:0005634nucleus
GO:0005694chromosome
GO:0043231intracellular membrane-bounded organelle
GO:0031974membrane-enclosed lumen
GO:0031981nuclear lumen
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043228non-membrane-bounded organelle
GO:0043229intracellular organelle
GO:0043232intracellular non-membrane-bounded organelle
GO:0043233organelle lumen
GO:0044422organelle part
GO:0044424intracellular part
GO:0044427chromosomal part
GO:0044428nuclear part
GO:0044446intracellular organelle part
GO:0044454nuclear chromosome part
GO:0044464cell part
GO:0070013intracellular organelle lumen