Overview
NameMedtr0002s1220.1
Unique NameMedtr0002s1220.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length594
Homology
BLAST of Medtr0002s1220.1 vs. NCBI nr
Match: gi|147823313|emb|CAN77449.1| (hypothetical protein VITISV_016970 [Vitis vinifera])
BLAST of Medtr0002s1220.1 vs. NCBI nr
Match: gi|255580859|ref|XP_002531249.1| (hypothetical protein RCOM_0494170 [Ricinus communis] >gi|223529168|gb|EEF31146.1| hypothetical protein RCOM_0494170 [Ricinus communis])
BLAST of Medtr0002s1220.1 vs. NCBI nr
Match: gi|255549333|ref|XP_002515720.1| (conserved hypothetical protein [Ricinus communis] >gi|223545157|gb|EEF46667.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0002s1220.1 vs. NCBI nr
Match: gi|502153304|ref|XP_004509293.1| (PREDICTED: uncharacterized protein LOC101498547 [Cicer arietinum])
BLAST of Medtr0002s1220.1 vs. NCBI nr
Match: gi|255581921|ref|XP_002531759.1| (conserved hypothetical protein [Ricinus communis] >gi|223528595|gb|EEF30615.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0002s1220.1 vs. NCBI nr
Match: gi|255569916|ref|XP_002525921.1| (conserved hypothetical protein [Ricinus communis] >gi|223534750|gb|EEF36441.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0002s1220.1 vs. NCBI nr
Match: gi|224061799|ref|XP_002300604.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0002s1220.1 vs. NCBI nr
Match: gi|224100433|ref|XP_002334374.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0002s1220.1 vs. NCBI nr
Match: gi|255553785|ref|XP_002517933.1| (conserved hypothetical protein [Ricinus communis] >gi|223542915|gb|EEF44451.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0002s1220.1 vs. NCBI nr
Match: gi|351723061|ref|NP_001235218.1| (uncharacterized protein LOC100527633 [Glycine max] >gi|255632818|gb|ACU16762.1| unknown [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0002s1220.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|147823313|emb|CAN77449.1|3.025620e-1537.39hypothetical protein VITISV_016970 [Vitis vinifera... [more]
gi|255580859|ref|XP_002531249.1|5.664750e-1442.72hypothetical protein RCOM_0494170 [Ricinus communi... [more]
gi|255549333|ref|XP_002515720.1|3.191410e-1132.79conserved hypothetical protein [Ricinus communis] ... [more]
gi|502153304|ref|XP_004509293.1|4.891090e-1147.69PREDICTED: uncharacterized protein LOC101498547 [C... [more]
gi|255581921|ref|XP_002531759.1|1.291440e-930.48conserved hypothetical protein [Ricinus communis] ... [more]
gi|255569916|ref|XP_002525921.1|3.631090e-928.26conserved hypothetical protein [Ricinus communis] ... [more]
gi|224061799|ref|XP_002300604.1|4.548630e-831.03predicted protein [Populus trichocarpa][more]
gi|224100433|ref|XP_002334374.1|8.212590e-831.03predicted protein [Populus trichocarpa][more]
gi|255553785|ref|XP_002517933.1|8.313390e-830.51conserved hypothetical protein [Ricinus communis] ... [more]
gi|351723061|ref|NP_001235218.1|2.362290e-735.92uncharacterized protein LOC100527633 [Glycine max]... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s1220.1 ID=Medtr0002s1220.1|Name=Medtr0002s1220.1|organism=Medicago truncatula|type=mRNA|length=594bp
ATGTGTCGGAAACCTGTCAAGTTATTTTTGAATGTGCGCGTAAGTTGTTA
CAAGGATGGAAGGAAGCATATATGTGTAAAGCTAGGCTGGGGGAGGGCGA
ACAACACCGTATCAGCCGACAGGAGCAGCAGTTCAGTGCTGGGAGAGGGC
GAACAGCAACCTGCTATGCGTGCTGTCAGCACCATATCAGCTGGCGGCAG
CAATTCCACACAGCAGCAGCACATCAGGTGGCAGAAACCAGGCACGGGAA
GGCTTAAGTGTAATGTTGACGCGGAATTCACGAGATCCTTGAATGTTATT
GGTGTTGATATGTTTATAAGGGACGAAGCTGGACAGTTTGTGGCAGCCAA
GACGCTACGGTCTAGTCCTATATGTGAATCGGGTATAGGTGAAGCTTTGG
GCCTCTCATACGCTATCCAATGGGTACATGAGCTGAAACTCACTAATGTC
GACTTTGAGATGGATGCCAAAAGGGTTGTAGATTATTACAATAAGGTAAG
CAATGATATATCTGAATTCAGCGCAACCATTGATGATTGTAGACGTCGAT
GTTGTTATTGGTTTGAAAACTCTAAGACAAAAAGAGCTGCGTAA
back to top