Overview
NameMedtr0002s1180.1
Unique NameMedtr0002s1180.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length2433
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00999.16441201-44004439-4242-381147.62.2e-47147.63e-43

Homology
BLAST of Medtr0002s1180.1 vs. NCBI nr
Match: gi|502161119|ref|XP_004512035.1| (PREDICTED: cation/H(+) antiporter 15-like [Cicer arietinum])
BLAST of Medtr0002s1180.1 vs. NCBI nr
Match: gi|356527917|ref|XP_003532552.1| (PREDICTED: cation/H(+) antiporter 15-like [Glycine max])
BLAST of Medtr0002s1180.1 vs. NCBI nr
Match: gi|356571083|ref|XP_003553710.1| (PREDICTED: cation/H(+) antiporter 15-like [Glycine max])
BLAST of Medtr0002s1180.1 vs. NCBI nr
Match: gi|356504020|ref|XP_003520797.1| (PREDICTED: cation/H(+) antiporter 15-like [Glycine max])
BLAST of Medtr0002s1180.1 vs. NCBI nr
Match: gi|502130207|ref|XP_004500568.1| (PREDICTED: cation/H(+) antiporter 15-like [Cicer arietinum])
BLAST of Medtr0002s1180.1 vs. NCBI nr
Match: gi|356537984|ref|XP_003537486.1| (PREDICTED: cation/H(+) antiporter 15-like [Glycine max])
BLAST of Medtr0002s1180.1 vs. NCBI nr
Match: gi|502122533|ref|XP_004497791.1| (PREDICTED: cation/H(+) antiporter 15-like [Cicer arietinum])
BLAST of Medtr0002s1180.1 vs. NCBI nr
Match: gi|502165154|ref|XP_004513443.1| (PREDICTED: cation/H(+) antiporter 15-like [Cicer arietinum])
BLAST of Medtr0002s1180.1 vs. NCBI nr
Match: gi|356518946|ref|XP_003528136.1| (PREDICTED: cation/H(+) antiporter 15-like [Glycine max])
BLAST of Medtr0002s1180.1 vs. NCBI nr
Match: gi|356533422|ref|XP_003535263.1| (PREDICTED: cation/H(+) antiporter 15-like [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0002s1180.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502161119|ref|XP_004512035.1|0.000000e+075.96PREDICTED: cation/H(+) antiporter 15-like [Cicer a... [more]
gi|356527917|ref|XP_003532552.1|0.000000e+069.14PREDICTED: cation/H(+) antiporter 15-like [Glycine... [more]
gi|356571083|ref|XP_003553710.1|0.000000e+067.70PREDICTED: cation/H(+) antiporter 15-like [Glycine... [more]
gi|356504020|ref|XP_003520797.1|0.000000e+066.83PREDICTED: cation/H(+) antiporter 15-like [Glycine... [more]
gi|502130207|ref|XP_004500568.1|0.000000e+048.86PREDICTED: cation/H(+) antiporter 15-like [Cicer a... [more]
gi|356537984|ref|XP_003537486.1|0.000000e+048.51PREDICTED: cation/H(+) antiporter 15-like [Glycine... [more]
gi|502122533|ref|XP_004497791.1|0.000000e+048.98PREDICTED: cation/H(+) antiporter 15-like [Cicer a... [more]
gi|502165154|ref|XP_004513443.1|0.000000e+045.23PREDICTED: cation/H(+) antiporter 15-like [Cicer a... [more]
gi|356518946|ref|XP_003528136.1|0.000000e+046.24PREDICTED: cation/H(+) antiporter 15-like [Glycine... [more]
gi|356533422|ref|XP_003535263.1|0.000000e+045.75PREDICTED: cation/H(+) antiporter 15-like [Glycine... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 743..748
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s1180.1 ID=Medtr0002s1180.1|Name=Medtr0002s1180.1|organism=Medicago truncatula|type=mRNA|length=2433bp
ATGAAGCATGTCACGCCTCCTGCATATTTTGAAGTAAATGTGATTAATTC
TAATCGAATATGGCAAACGGACAATGTTATAAAAACTGGGGTCGCCTATA
ATGCCGCGACAATTGTCGCCATCATAGTTGTGTCTCGTTTTTGCTTCTTT
ATCTTTAAACCCCTTCATCAATCTCGCATCATTGCACATATCGCTGCTGG
TATTGTATTACCATTGCTATGGGCTTTTGCACCATCTACGGCCCTATACC
TTTTTCCTGTATCTAATATGATCAGTGTCGAAGTTATATCAACTATTGGT
GTTATATATTATGCATTCCTAAGTGGTTTGGAGGTGAACTTGAATACCAT
TTTACATGTTAAAAAGAAAGCTGCAACTATTGCAATTTCTGGGATAATTT
TTCCAATGGTGATGGGACCAGCTTTATACCTTCTACATCGAAAATTTTAT
GGCAAGGGTGATGGATCTAATCTTGAAGAAAGTACAATAAATGTTTATAT
ATTATGGACTTTAGTTCTTACTGTGACAGGTTTTCCAGTTGTAGTCCACA
CCCTGTCTGAGCTTAAACTTCTCTATACTGGTCTTGGGAAGGTTGCATTA
ACATCAGCCATGATCAGTGACACATATGCTTGGATTTTATTCGTATTATT
TGTTCCATTTTCAGTTAATGGTACAGAGGCAATATACACGACGTTAAGCA
CTGCAATATTTATATTCATTTCCATCTTTGTGGTGCATCCTATCATTGTA
AAGGTCATTGATCGCAAGACAGAAAGAGATGAATGGGATGCTAACCAACT
AGTTTTTGTCTTTATGGGCCTTATGGTTTTCTCATTCATAGCCGATACTC
TTGGCACACATGATGTTGTTGGGGCTTTTTTATACGGGTTGATTTTACCT
CACGGTAAATTTGCTGACATGGTCGTGTCAATGACTAATGATTTTGGTAT
TGGCTTTCTTGCACCGATCTACTTTTGTGGCAATGGATCAAAACTCATGG
TGAAAACCATTTTCTTTCAGCCAAATTGTGCCTATACACTTATCATTATA
CTCTTGTTGTGTGTTCCAAAGATTTTAAGCACTTTGTTTGCCACTTTCTT
CTTTGGCATGCGTGCTCAAGATGGTTTTGCTCTAGGCTTGCTTCTCAATA
CCAAGGGTGTCGTTGCACTGATAATGCTCAATATTTCCTGGGATAGATCG
ATTCTTTCTCCACCAACATATGCTGTTTTAACCTCTGCAGTTCTTCTAAT
GACTATAGTGGTGGCTCCTGTCATCAATGCCATATACAAGCCCAGAAAGA
GATTTGAGAATAATAAGCTAAAGACTATACAAAAGCTTAGACTTGATGCA
GAGCTTAGGATTCTAGCATGTGTTCACAATACTCGTCAGGCCGTAGGAGT
TATTAGCCTCATTGAATATTTCAATGCCACTAGAATTTCCCCTATACATG
TTTTTGGCCTTTACCTTGTTGAAATCGTTGGACGTGTTGGTGCCCTTGTT
GCTTCTCATATGGAAAAATCTAGTGGCCAATCTGGAACACAAAATCTTAC
ACAATCCCAGCTAGAGTTAGAAAGCATTACCAATACCTTTGAAGCATTCA
AAGAGGCATATGATGCTATTAGAGTCCAAACACTAAATGTTGTGTCAAAC
TATGCAACCATTCACGAAGATATATACAACTCGGCTAATGAAAAATGTAC
AAGTTTGATTCTCCTTCCATTCCACAAACAACTAAGTTCAGAAGGTGCAC
TCGAAACAACTAATACTGCATACAAAGATATAAACTTGAATGTGATGCAA
AGTGCACCTTGCTCTGTGGGAATATTTGTGGACCGTGATCTTGGGTCATT
ACCAACTTTAAATTTTCGTATTTGTATGATCTTTGTTGGTGGTCCTGATG
ATCGCGAAGCCTTAGCTGTTGCATGGAGAATGGCAGGACGCATAGGAACC
CAATTATCAGTGGTTCGGATGCTCCTGTTTGATAATGCTGAAATAGTAGA
CACCTCAAGTCATGCTGAACCACAAGGGATACTATCTATTGTAATGGATA
GTGAGAAGCAGAAGGAGTTAGATGATGAGTATGTGAATGGATTTAGATTG
ACAGCGATGAACAACAATGATTCTATATCTTATTCAGAAGTTAATGTCCA
TTCAGGTGAAGATATTCCCACAACCCTCAATGAACTAGAAAATTTTTATT
GCAATTTATATATAGTTGGACAAGGGAATCGTAGGAACAATCGTGTCTTT
TTAAATTTATTGGACTGGTGTGATTGTCCAGAACTTGGAGTTTTAGGGGA
CATTTTGGCATCAGATAATTTTGTTTCGAGATCATCTGTGCTAGTTGTGC
AACAATATGGGTATGGGGGAATGGTTTTGGAAAAGCAACCCAACCATGTG
ACCACCAATAACGATGGTTTTGAGTGGTTGTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated