Overview
NameMedtr0002s0960.1
Unique NameMedtr0002s0960.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length567
Homology
BLAST of Medtr0002s0960.1 vs. NCBI nr
Match: gi|356540662|ref|XP_003538805.1| (PREDICTED: uncharacterized protein LOC100806642 [Glycine max])
BLAST of Medtr0002s0960.1 vs. NCBI nr
Match: gi|356502140|ref|XP_003519879.1| (PREDICTED: uncharacterized protein LOC100786989 [Glycine max])
BLAST of Medtr0002s0960.1 vs. NCBI nr
Match: gi|356560241|ref|XP_003548402.1| (PREDICTED: uncharacterized protein LOC100788372 [Glycine max])
BLAST of Medtr0002s0960.1 vs. NCBI nr
Match: gi|356523519|ref|XP_003530385.1| (PREDICTED: uncharacterized protein LOC100799804 [Glycine max])
BLAST of Medtr0002s0960.1 vs. NCBI nr
Match: gi|356569818|ref|XP_003553092.1| (PREDICTED: uncharacterized protein LOC100807161 [Glycine max])
BLAST of Medtr0002s0960.1 vs. NCBI nr
Match: gi|356566644|ref|XP_003551540.1| (PREDICTED: uncharacterized protein LOC100776668 [Glycine max])
BLAST of Medtr0002s0960.1 vs. NCBI nr
Match: gi|356553674|ref|XP_003545178.1| (PREDICTED: uncharacterized protein LOC100783555 [Glycine max])
BLAST of Medtr0002s0960.1 vs. NCBI nr
Match: gi|356570109|ref|XP_003553233.1| (PREDICTED: uncharacterized protein LOC100808063 [Glycine max])
BLAST of Medtr0002s0960.1 vs. NCBI nr
Match: gi|356510705|ref|XP_003524076.1| (PREDICTED: uncharacterized protein LOC100807907 [Glycine max])
BLAST of Medtr0002s0960.1 vs. NCBI nr
Match: gi|356570048|ref|XP_003553204.1| (PREDICTED: uncharacterized protein LOC100801132 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0960.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356540662|ref|XP_003538805.1|3.431620e-3464.95PREDICTED: uncharacterized protein LOC100806642 [G... [more]
gi|356502140|ref|XP_003519879.1|6.774750e-3464.95PREDICTED: uncharacterized protein LOC100786989 [G... [more]
gi|356560241|ref|XP_003548402.1|1.541800e-3364.95PREDICTED: uncharacterized protein LOC100788372 [G... [more]
gi|356523519|ref|XP_003530385.1|1.721710e-3365.98PREDICTED: uncharacterized protein LOC100799804 [G... [more]
gi|356569818|ref|XP_003553092.1|2.014010e-3363.92PREDICTED: uncharacterized protein LOC100807161 [G... [more]
gi|356566644|ref|XP_003551540.1|3.344770e-3363.92PREDICTED: uncharacterized protein LOC100776668 [G... [more]
gi|356553674|ref|XP_003545178.1|3.344960e-3363.92PREDICTED: uncharacterized protein LOC100783555 [G... [more]
gi|356570109|ref|XP_003553233.1|3.837260e-3364.58PREDICTED: uncharacterized protein LOC100808063 [G... [more]
gi|356510705|ref|XP_003524076.1|9.395930e-3363.92PREDICTED: uncharacterized protein LOC100807907 [G... [more]
gi|356570048|ref|XP_003553204.1|1.354730e-3262.89PREDICTED: uncharacterized protein LOC100801132 [G... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0960.1 ID=Medtr0002s0960.1|Name=Medtr0002s0960.1|organism=Medicago truncatula|type=mRNA|length=567bp
ATGATGTTGGATAAATTGGTTGATTTAGATGAAGAAAGGCCGACTGCATT
GGACATACGTTTGAGACAAAAAGAACGTGGTGCAAAAACCTATAATAAAA
AGGTAAAATCAAAATCATTCAATATTGGAGATTTGGTTTTAAAAGTACTT
TTTCCTATGGACAAAAAAGACAAAGTCTTAGGTAAGTGGTCACTGAATTG
GGAAGGACCATTTGAAGTTATACAAGTATTTTCAATTGGTGTTTATGAAA
TTGAAGAATTGGCTTCCGAAAAAAGAATATTCAGAATGAAAGTTGAAATC
CCAAAAATCGAAATGCTCAAGGAACCAGACAAGTTGGAGATCGAGGTGAC
ATCAGAGACAAAAGTTGGTCCCATGATAGTCCTCATATGCACCTTGGAGG
GGCGAGTTGGTGTGTCGAATTCTTCTGATCCCTTCATAAGCCCTATTGGT
AGGACAAGAGAATTGATATTTCAAACCTCAAAGCATAGGCCTAAAGAAGA
GAACATTCAATATGAAAAATGTGGACCCACCGTATTCAAGATAGTATCCC
TGCAGTTGGCGAGTTGA
back to top