Overview
NameMedtr0002s0900.1
Unique NameMedtr0002s0900.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length753
Homology
BLAST of Medtr0002s0900.1 vs. NCBI nr
Match: gi|502123805|ref|XP_004498266.1| (PREDICTED: lysine-rich arabinogalactan protein 19-like [Cicer arietinum])
BLAST of Medtr0002s0900.1 vs. NCBI nr
Match: gi|356500002|ref|XP_003518824.1| (PREDICTED: lysine-rich arabinogalactan protein 19-like [Glycine max])
BLAST of Medtr0002s0900.1 vs. NCBI nr
Match: gi|359807508|ref|NP_001241145.1| (uncharacterized protein LOC100785574 precursor [Glycine max] >gi|255637288|gb|ACU18974.1| unknown [Glycine max])
BLAST of Medtr0002s0900.1 vs. NCBI nr
Match: gi|356496026|ref|XP_003516871.1| (PREDICTED: lysine-rich arabinogalactan protein 19-like [Glycine max])
BLAST of Medtr0002s0900.1 vs. NCBI nr
Match: gi|356511178|ref|XP_003524306.1| (PREDICTED: proline-rich extensin-like protein EPR1-like [Glycine max])
BLAST of Medtr0002s0900.1 vs. NCBI nr
Match: gi|356527512|ref|XP_003532353.1| (PREDICTED: uncharacterized protein LOC100776625 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0900.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 6
Match NameE-valueIdentityDescription
gi|502123805|ref|XP_004498266.1|1.523800e-4676.80PREDICTED: lysine-rich arabinogalactan protein 19-... [more]
gi|356500002|ref|XP_003518824.1|1.826800e-2773.53PREDICTED: lysine-rich arabinogalactan protein 19-... [more]
gi|359807508|ref|NP_001241145.1|3.138270e-1971.28uncharacterized protein LOC100785574 precursor [Gl... [more]
gi|356496026|ref|XP_003516871.1|2.868000e-1569.15PREDICTED: lysine-rich arabinogalactan protein 19-... [more]
gi|356511178|ref|XP_003524306.1|1.184570e-740.39PREDICTED: proline-rich extensin-like protein EPR1... [more]
gi|356527512|ref|XP_003532353.1|1.362200e-441.96PREDICTED: uncharacterized protein LOC100776625 [G... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 23..54
score: NAcoord: 71..165
score: NAcoord: 168..181
score: NAcoord: 194..215
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0900.1 ID=Medtr0002s0900.1|Name=Medtr0002s0900.1|organism=Medicago truncatula|type=mRNA|length=753bp
ATGGCTACAATGTTCTGGGTTATGACTTTACTAAGCCTCAGTTGCCTGCT
AGGATTCAACGCCCAAGCACCAGCAACTGCACCAACAAAGTTGCCACCTA
CAACCCCGACGGCAATAACACCGGTCACGACACAACCACCTACCGTGGTG
GCATCTCCTCCCATCACAAGCCAACCACCTGTTACCGTGGCACCCAAATC
TGCTCCAGTTACATCACCAGCTCCAAAAATTGCACCAGCTTCAAGCCCAA
AAGTCCCACCACCTCAACCACCAAAAAGTTCACCTGTCTCAACTCCAACA
TTGCCACCACCGTTGCCACCACCACCAAAGATATCACCAACACCAGTCCA
AACACCACCAGCCCCTGCACCAGTAAAGGCAACACCGGTGCCAGCACCTG
CACCCGCAAAGCAAGCGCCAACTCCTGCACCTGCTACCTCACCACCAATA
CCCGCACCAACGCCTGCAATAGAAGCACCTGTACCAGCACCTGAGTCCTC
CAAGCACAAGAGAAGAAGACATAGACACAAGCACAGGAGACATCAAGCAC
CAGCTCCAGCACCAACCGTTATTCACAAGAGTCCCCCTGCACCACCAACT
GACACTACAGCAGATTCCGACACAGCACCGGCACCAGCACCTAGTCTTAA
TTTGAATGGTGCACCATCAAACCATCTTCAAGGGGGAAATATATGGACAA
CAATTGGATTTGCTATTACTGTTTTTCTAGCAGTAACGGGCTACAGCTTC
TAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated