Overview
NameMedtr0002s0820.1
Unique NameMedtr0002s0820.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length486
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0019438 aromatic compound biosynthetic process
biological_process GO:0008150 biological_process
biological_process GO:0009058 biosynthetic process
biological_process GO:0006725 cellular aromatic compound metabolic process
biological_process GO:0044249 cellular biosynthetic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0008152 metabolic process
biological_process GO:1901362 organic cyclic compound biosynthetic process
biological_process GO:1901360 organic cyclic compound metabolic process
biological_process GO:1901576 organic substance biosynthetic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0055114 oxidation-reduction process
biological_process GO:0009699 phenylpropanoid biosynthetic process
biological_process GO:0009698 phenylpropanoid metabolic process
biological_process GO:0019748 secondary metabolic process
biological_process GO:0044550 secondary metabolite biosynthetic process
biological_process GO:0044711 single-organism biosynthetic process
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044710 single-organism metabolic process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
molecular_function GO:0003824 catalytic activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0016491 oxidoreductase activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00171.17286230-28638592-143215-26546.51e-1677.17.5e-22

Homology
BLAST of Medtr0002s0820.1 vs. NCBI nr
Match: gi|502152285|ref|XP_004508854.1| (PREDICTED: aldehyde dehydrogenase family 2 member B7, mitochondrial-like isoform X2 [Cicer arietinum])
BLAST of Medtr0002s0820.1 vs. NCBI nr
Match: gi|502152283|ref|XP_004508853.1| (PREDICTED: aldehyde dehydrogenase family 2 member B7, mitochondrial-like isoform X1 [Cicer arietinum])
BLAST of Medtr0002s0820.1 vs. NCBI nr
Match: gi|442556967|gb|AGC54942.1| (mitochondrial aldehyde dehydrogenase, partial [Gossypium hirsutum])
BLAST of Medtr0002s0820.1 vs. NCBI nr
Match: gi|356562748|ref|XP_003549631.1| (PREDICTED: LOW QUALITY PROTEIN: aldehyde dehydrogenase family 2 member B4, mitochondrial-like [Glycine max])
BLAST of Medtr0002s0820.1 vs. NCBI nr
Match: gi|595857560|ref|XP_007210569.1| (hypothetical protein PRUPE_ppa003869mg [Prunus persica] >gi|462406304|gb|EMJ11768.1| hypothetical protein PRUPE_ppa003869mg [Prunus persica])
BLAST of Medtr0002s0820.1 vs. NCBI nr
Match: gi|15228319|ref|NP_190383.1| (aldehyde dehydrogenase 2B4 [Arabidopsis thaliana] >gi|75313899|sp|Q9SU63.1|AL2B4_ARATH RecName: Full=Aldehyde dehydrogenase family 2 member B4, mitochondrial; Short=ALDH2a; Flags: Precursor [Arabidopsis thaliana] >gi|11935201|gb|AAG42016.1|AF327426_1 putative (NAD+) aldehyde dehydrogenase [Arabidopsis thaliana] >gi|13194814|gb|AAK15569.1|AF349522_1 putative aldehyde dehydrogenase (NAD+) [Arabidopsis thaliana] >gi|13926325|gb|AAK49627.1|AF372911_1 AT3g48000/T17F15_130 [Arabidopsis thaliana] >gi|4678328|emb|CAB41139.1| aldehyde dehydrogenase (NAD+)-like protein [Arabidopsis thaliana] >gi|8574427|dbj|BAA96792.1| aldehyde dehydrogenase [Arabidopsis thaliana] >gi|19699355|gb|AAL91287.1| AT3g48000/T17F15_130 [Arabidopsis thaliana] >gi|20530141|gb|AAM27003.1| aldehyde dehydrogenase ALDH2a [Arabidopsis thaliana] >gi|23397220|gb|AAN31892.1| putative aldehyde dehydrogenase (NAD+) [Arabidopsis thaliana] >gi|30102522|gb|AAP21179.1| At3g48000/T17F15_130 [Arabidopsis thaliana] >gi|332644834|gb|AEE78355.1| aldehyde dehydrogenase 2B4 [Arabidopsis thaliana])
BLAST of Medtr0002s0820.1 vs. NCBI nr
Match: gi|297819414|ref|XP_002877590.1| (ALDH2B4 [Arabidopsis lyrata subsp. lyrata] >gi|297323428|gb|EFH53849.1| ALDH2B4 [Arabidopsis lyrata subsp. lyrata])
BLAST of Medtr0002s0820.1 vs. NCBI nr
Match: gi|73647788|gb|AAZ79358.1| (aldehyde dehydrogenase [Vitis pseudoreticulata])
BLAST of Medtr0002s0820.1 vs. NCBI nr
Match: gi|460385976|ref|XP_004238676.1| (PREDICTED: aldehyde dehydrogenase family 2 member B7, mitochondrial-like [Solanum lycopersicum])
BLAST of Medtr0002s0820.1 vs. NCBI nr
Match: gi|73647513|gb|AAZ79355.1| (aldehyde dehydrogenase [Vitis pseudoreticulata])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0820.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502152285|ref|XP_004508854.1|1.609250e-1949.17PREDICTED: aldehyde dehydrogenase family 2 member ... [more]
gi|502152283|ref|XP_004508853.1|2.542620e-1949.17PREDICTED: aldehyde dehydrogenase family 2 member ... [more]
gi|442556967|gb|AGC54942.1|1.419680e-1875.47mitochondrial aldehyde dehydrogenase, partial [Gos... [more]
gi|356562748|ref|XP_003549631.1|2.462140e-1847.50PREDICTED: LOW QUALITY PROTEIN: aldehyde dehydroge... [more]
gi|595857560|ref|XP_007210569.1|3.118450e-1849.15hypothetical protein PRUPE_ppa003869mg [Prunus per... [more]
gi|15228319|ref|NP_190383.1|5.687500e-1877.19aldehyde dehydrogenase 2B4 [Arabidopsis thaliana] ... [more]
gi|297819414|ref|XP_002877590.1|5.889780e-1877.19ALDH2B4 [Arabidopsis lyrata subsp. lyrata] >gi|297... [more]
gi|73647788|gb|AAZ79358.1|9.723100e-1847.83aldehyde dehydrogenase [Vitis pseudoreticulata][more]
gi|460385976|ref|XP_004238676.1|1.001500e-1754.95PREDICTED: aldehyde dehydrogenase family 2 member ... [more]
gi|73647513|gb|AAZ79355.1|1.022430e-1747.83aldehyde dehydrogenase [Vitis pseudoreticulata][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR016160Aldehyde dehydrogenase, conserved sitePROSITEPS00687ALDEHYDE_DEHYDR_GLUcoord: 3..10
score: NAcoord: 112..119
score
IPR016161Aldehyde/histidinol dehydrogenaseSUPERFAMILY53720ALDH-likecoord: 92..143
score: 9e-13coord: 2..34
score: 1.6
IPR016162Aldehyde dehydrogenase, N-terminalGENE3D3.40.605.10no descriptioncoord: 2..34
score: 1.6e-07coord: 92..143
score: 2.4
NoneNo IPR availableSEGsegsegcoord: 149..161
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0820.1 ID=Medtr0002s0820.1|Name=Medtr0002s0820.1|organism=Medicago truncatula|type=mRNA|length=486bp
ATGACATTAGAACTTGGAGGGAAATCGCCTTTCATTGTCTTTGAGGAAGC
TGATATTGACAAGGTTGTTGAAATTGCTCACTTTGCTCTTTGCTTTAATC
AGTTGTTTCATCATCTTCAAGTGTTGATTGGTGTATCAGTTCTTGTTGGA
GGAGATATTGGAGGTCCTTTGGTGCTGGAGTGGTATGGTTCAATCGATTT
AGCTTTTAGGTGTTCTGTCTACGATGGTGATTTTGTGAGTGAGTATGGTA
CGATGGAAGAAGGCTTCAGATTGACGGACATTGGAAAAACTATACTTCAA
CTGGCTGCAAGAAGCAATCTTAAGCCGATGACATTAGAACTTGGAGGGAA
ATCGCCTTTCATTGTCTTTGAGGAAGCTGATATTGACAAGGTTGTTGAAA
TTGCTCACTTTGCTCTTTGCTTTAATCAGGTTTATATTCCTTGTCTCATT
TTTTCTTTTTCTTCTTCTGTTCTTGTGTTGATTTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR016160Aldehyde dehydrogenase, conserved site
IPR016161Aldehyde/histidinol dehydrogenase
IPR016162Aldehyde dehydrogenase, N-terminal
noIPRunintegrated
Vocabulary: Biological Process
TermDefinition
GO:0008152metabolic process
GO:0055114oxidation-reduction process
GO:0006725cellular aromatic compound metabolic process
GO:0008150biological_process
GO:0009058biosynthetic process
GO:0009698phenylpropanoid metabolic process
GO:0009699phenylpropanoid biosynthetic process
GO:0009987cellular process
GO:0019438aromatic compound biosynthetic process
GO:0019748secondary metabolic process
GO:0044237cellular metabolic process
GO:0044249cellular biosynthetic process
GO:0044550secondary metabolite biosynthetic process
GO:0044699single-organism process
GO:0044710single-organism metabolic process
GO:0044711single-organism biosynthetic process
GO:0044763single-organism cellular process
GO:0071704organic substance metabolic process
GO:1901360organic cyclic compound metabolic process
GO:1901362organic cyclic compound biosynthetic process
GO:1901576organic substance biosynthetic process
Vocabulary: Molecular Function
TermDefinition
GO:0016491oxidoreductase activity
GO:0003674molecular_function
GO:0003824catalytic activity
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0044464cell part