Overview
NameMedtr0002s0780.1
Unique NameMedtr0002s0780.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length753
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0040007 growth
biological_process GO:0006412 translation
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0015934 large ribosomal subunit
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005739 mitochondrion
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
cellular_component GO:0005840 ribosome
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
molecular_function GO:0019843 rRNA binding
molecular_function GO:0003735 structural constituent of ribosome
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00238.14277945-277601136-2509-122137.91.7e-44138.57.5e-41
PF00252.13278296-27794019-1371-122151.02e-48151.78e-45

Homology
BLAST of Medtr0002s0780.1 vs. NCBI nr
Match: gi|255554452|ref|XP_002518265.1| (50S ribosomal protein L14, putative [Ricinus communis] >gi|223542612|gb|EEF44151.1| 50S ribosomal protein L14, putative [Ricinus communis])
BLAST of Medtr0002s0780.1 vs. NCBI nr
Match: gi|118430424|ref|YP_874690.1| (ribosomal protein L16 [Hordeum vulgare subsp. vulgare] >gi|215275567|sp|A1E9M8.1|RK16_HORVU RecName: Full=50S ribosomal protein L16, chloroplastic (chloroplast) [Hordeum vulgare] >gi|118201078|gb|ABK79449.1| ribosomal protein L16 [Hordeum vulgare subsp. vulgare])
BLAST of Medtr0002s0780.1 vs. NCBI nr
Match: gi|114812068|ref|YP_654241.2| (ribosomal protein L16 [Oryza sativa Indica Group])
BLAST of Medtr0002s0780.1 vs. NCBI nr
Match: gi|372481719|gb|AEX94532.1| (ribosomal protein L16 (chloroplast) [Kniphofia linearifolia])
BLAST of Medtr0002s0780.1 vs. NCBI nr
Match: gi|372481715|gb|AEX94530.1| (ribosomal protein L16 (chloroplast) [Asphodeline damascena])
BLAST of Medtr0002s0780.1 vs. NCBI nr
Match: gi|372481713|gb|AEX94529.1| (ribosomal protein L16 (chloroplast) [Aloe vera])
BLAST of Medtr0002s0780.1 vs. NCBI nr
Match: gi|372481699|gb|AEX94522.1| (ribosomal protein L16 (chloroplast) [Crinum asiaticum])
BLAST of Medtr0002s0780.1 vs. NCBI nr
Match: gi|372481675|gb|AEX94510.1| (ribosomal protein L16 (chloroplast) [Agapanthus africanus])
BLAST of Medtr0002s0780.1 vs. NCBI nr
Match: gi|372481693|gb|AEX94519.1| (ribosomal protein L16 (chloroplast) [Gilliesia graminea])
BLAST of Medtr0002s0780.1 vs. NCBI nr
Match: gi|372481745|gb|AEX94545.1| (ribosomal protein L16 (chloroplast) [Eriospermum cervicorne])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0780.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|255554452|ref|XP_002518265.1|7.491110e-9064.6650S ribosomal protein L14, putative [Ricinus commu... [more]
gi|118430424|ref|YP_874690.1|5.823970e-8098.36ribosomal protein L16 [Hordeum vulgare subsp. vulg... [more]
gi|114812068|ref|YP_654241.2|4.036570e-7892.80ribosomal protein L16 [Oryza sativa Indica Group][more]
gi|372481719|gb|AEX94532.1|4.910600e-7792.74ribosomal protein L16 (chloroplast) [Kniphofia lin... [more]
gi|372481715|gb|AEX94530.1|5.184710e-7791.27ribosomal protein L16 (chloroplast) [Asphodeline d... [more]
gi|372481713|gb|AEX94529.1|5.779660e-7792.74ribosomal protein L16 (chloroplast) [Aloe vera][more]
gi|372481699|gb|AEX94522.1|7.749630e-7792.74ribosomal protein L16 (chloroplast) [Crinum asiati... [more]
gi|372481675|gb|AEX94510.1|8.638880e-7791.94ribosomal protein L16 (chloroplast) [Agapanthus af... [more]
gi|372481693|gb|AEX94519.1|9.121060e-7791.94ribosomal protein L16 (chloroplast) [Gilliesia gra... [more]
gi|372481745|gb|AEX94545.1|1.050450e-7692.74ribosomal protein L16 (chloroplast) [Eriospermum c... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000114Ribosomal protein L16PRINTSPR00060RIBOSOMALL16coord: 39..51
score: 1.2e-40coord: 57..68
score: 1.2e-40coord: 73..102
score: 1.2e-40coord: 103..132
score: 1.2
IPR000114Ribosomal protein L16TIGRFAMsTIGR01164rplP_bact: ribosomal protein L16coord: 17..142
score: 1.3
IPR005745Ribosomal protein L14, bacterial-typeTIGRFAMsTIGR01067rplN_bact: ribosomal protein L14coord: 128..250
score: 3.7
IPR016180Ribosomal protein L10e/L16SUPERFAMILY54686Ribosomal protein L16p/L10ecoord: 18..149
score: 1.1
IPR019972Ribosomal protein L14 conserved sitePROSITEPS00049RIBOSOMAL_L14coord: 188..214
score
IPR020798Ribosomal protein L16, conserved sitePROSITEPS00586RIBOSOMAL_L16_1coord: 74..85
score
IPR020798Ribosomal protein L16, conserved sitePROSITEPS00701RIBOSOMAL_L16_2coord: 97..108
score
IPR023571Ribosomal protein L14 domainGENE3D2.40.150.20no descriptioncoord: 136..250
score: 5.9
IPR023571Ribosomal protein L14 domainSUPERFAMILY50193Ribosomal protein L14coord: 128..250
score: 3.5
NoneNo IPR availableGENE3D3.90.1170.10no descriptioncoord: 28..122
score: 0.0

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0780.1 ID=Medtr0002s0780.1|Name=Medtr0002s0780.1|organism=Medicago truncatula|type=mRNA|length=753bp
ATGTCCAGTTTTGGAGTAGAGATGGAACTAAGAAAGAGAACCATCGACTA
TAACCCCAAAAGAACCAGATTTCGCAAACAACATAGAGGAAGAATGAAAG
GAAAATCCTTCCGAGGCAATCGTATTTGTTTTGGTAGATATGCTCTTCAA
GCACTTGAACCCGCTTGGATCACGGCGAGACAGATAGAAGCAGGACGAAG
AGCAATAACACGATATGCACGTCGTGGTGGAAAAATATGGGTACGTATAT
TTCCCGACAAACCGGTTACACTAAGACCCACGGAAACACGTATGGGCTCG
GGAAAGGGGTCCCCCGAATATTGGGTAGCCGTTGTTAAACCAGGTCGTAT
ACTTTATGAAATGGGGGGAGTATCTGAAACTGTAGCTAGAGCAGCTATCT
CCATAGCGGCCACAGACAATAGTGGAGCTCGAAAATTGATGTGTATTCGA
GTCATAGGAGCTGCTGGTAATCAGCGATATGCTCGTATTGGTGATGTTAT
TGTTGCTGTAATCAAAGACGCATTGCCCCAAATGCCTCTAGAAAGATCCG
AAGTAATTCGAGCTGTAATTGTACGTACATGTAAAGAATTCAAATGCGAA
GACGGTATAATAATCCGCTATGATGACAATGCTGCGGTTATAATTGATCA
AAAAGGCAACCCAAAAGGAACTCGAGTTTTTGGCGCGATTGCCGAGGAAT
TGAGAGAATTGAATTTTACCAAAATAGTTTCATTAGCTCCTGAAGTATTA
TAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000114Ribosomal protein L16
IPR005745Ribosomal protein L14, bacterial-type
IPR016180Ribosomal protein L10e/L16
IPR019972Ribosomal protein L14 conserved site
IPR020798Ribosomal protein L16, conserved site
IPR023571Ribosomal protein L14 domain
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0003735structural constituent of ribosome
GO:0019843rRNA binding
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Biological Process
TermDefinition
GO:0006412translation
GO:0040007growth
GO:0008150biological_process
Vocabulary: Cellular Component
TermDefinition
GO:0015934large ribosomal subunit
GO:0005840ribosome
GO:0005622intracellular
GO:0005575cellular_component
GO:0005739mitochondrion
GO:0005623cell
GO:0005634nucleus
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part