Overview
NameMedtr0002s0700.1
Unique NameMedtr0002s0700.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length252
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0009767 photosynthetic electron transport chain
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0016021 integral component of membrane
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
cellular_component GO:0009539 photosystem II reaction center
cellular_component GO:0030096 plasma membrane-derived thylakoid photosystem II
cellular_component GO:0009536 plastid
molecular_function GO:0020037 heme binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00283.14262567-2624816-341-2955.43.3e-1956.01.5e-15
PF00284.15262459-26234342-801-3983.37.6e-2883.74e-24

Homology
BLAST of Medtr0002s0700.1 vs. NCBI nr
Match: gi|11466807|ref|NP_039403.1| (photosystem II protein V [Oryza sativa Japonica Group] >gi|11467208|ref|NP_043041.1| photosystem II protein V [Zea mays] >gi|48478787|ref|YP_024395.1| photosystem II protein V [Saccharum hybrid cultivar SP-80-3280] >gi|50233989|ref|YP_052767.1| photosystem II protein V [Oryza nivara] >gi|50812544|ref|YP_054647.1| photosystem II protein V [Saccharum hybrid cultivar NCo 310] >gi|118430319|ref|YP_874753.1| photosystem II protein V [Agrostis stolonifera] >gi|118430404|ref|YP_874669.1| photosystem II cytochrome b559 alpha subunit [Hordeum vulgare subsp. vulgare] >gi|118614509|ref|YP_899424.1| photosystem II cytochrome b559 alpha subunit [Sorghum bicolor] >gi|126507954|ref|YP_654226.2| photosystem II protein V [Oryza sativa Indica Group] >gi|194033165|ref|YP_002000503.1| photosystem II protein V [Brachypodium distachyon] >gi|253729573|ref|YP_003029756.1| PsbE [Bambusa oldhamii] >gi|255961399|ref|YP_003097592.1| photosystem II cytochrome b559 alpha subunit [Dendrocalamus latiflorus] >gi|260677435|ref|YP_003208203.1| photosystem II cytochrome b559 alpha subunit [Coix lacryma-jobi] >gi|339906468|ref|YP_004733261.1| photosystem II cytochrome b559 alpha subunit [Indocalamus longiauritus] >gi|340034043|ref|YP_004733595.1| photosystem II cytochrome b559 alpha subunit [Phyllostachys edulis] >gi|340034214|ref|YP_004733777.1| photosystem II cytochrome b559 alpha subunit [Acidosasa purpurea] >gi|340034382|ref|YP_004733995.1| photosystem II cytochrome b559 alpha subunit [Phyllostachys nigra var. henonis] >gi|340034467|ref|YP_004734118.1| photosystem II cytochrome b559 alpha subunit [Bambusa emeiensis] >gi|340034553|ref|YP_004734202.1| photosystem II cytochrome b559 alpha subunit [Ferrocalamus rimosivaginus] >gi|345895233|ref|YP_004841965.1| photosystem II cytochrome b559 alpha subunit [Panicum virgatum] >gi|374249283|ref|YP_005088026.1| psbE gene product [Leersia tisserantii] >gi|374249367|ref|YP_005088549.1| psbE gene product (chloroplast) [Phyllostachys propinqua] >gi|374249636|ref|YP_005089163.1| psbE gene product [Rhynchoryza subulata] >gi|378758431|ref|YP_005296435.1| psbE gene product (chloroplast) [Oryza meridionalis] >gi|386799187|ref|YP_006280776.1| psbE gene product (chloroplast) [Oryza rufipogon] >gi|426406655|ref|YP_007026569.1| photosystem II cytochrome b559 alpha subunit [Festuca ovina] >gi|427436991|ref|YP_007026483.1| photosystem II cytochrome b559 alpha subunit [Festuca altissima] >gi|452849499|ref|YP_007475156.1| photosystem II protein V (chloroplast) [Arundinaria gigantea] >gi|525778521|ref|YP_008239109.1| photosystem II cytochrome b559 alpha subunit (chloroplast) (chloroplast) [Triticum monococcum] >gi|525782232|ref|YP_008239188.1| photosystem II cytochrome b559 alpha subunit (chloroplast) (chloroplast) [Secale cereale] >gi|533310121|ref|YP_008474316.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Aegilops tauschii] >gi|533310217|ref|YP_008474407.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Aegilops speltoides] >gi|558603687|ref|YP_008815767.1| photosystem II cytochrome b559 alpha subunit [Setaria italica] >gi|563354796|ref|YP_008855107.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Phragmites australis] >gi|568245012|ref|YP_008963920.1| photosystem II cytochrome b559 alpha subunit (chloroplast) (chloroplast) [Aegilops geniculata] >gi|568247010|ref|YP_008963843.1| photosystem II cytochrome b559 alpha subunit (chloroplast) (chloroplast) [Aegilops cylindrica] >gi|589229838|ref|YP_009003845.1| photosystem II protein V [Deschampsia antarctica] >gi|595789870|ref|YP_009020154.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Sorghum timorense] >gi|608787574|ref|YP_009024271.1| photosystem II protein V (chloroplast) [Arundinaria appalachiana] >gi|608787658|ref|YP_009024354.1| photosystem II protein V (chloroplast) [Arundinaria tecta] >gi|642276462|ref|YP_009033460.1| photosystem II protein V [Olyra latifolia] >gi|649132379|ref|YP_009033986.1| photosystem II cytochrome b559 alpha subunit [Cenchrus americanus] >gi|649132500|ref|YP_009034113.1| photosystem II protein V [Oryza glaberrima] >gi|649132609|ref|YP_009034196.1| photosystem II cytochrome b559 alpha subunit [Digitaria exilis] >gi|651424257|ref|YP_009040422.1| photosystem II cytochrome b559 alpha subunit (chloroplast) (chloroplast) [Neyraudia reynaudiana] >gi|662020698|ref|YP_009029886.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Lecomtella madagascariensis] >gi|60390390|sp|Q6ENF6.3|PSBE_ORYNI RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Oryza nivara] >gi|60390395|sp|Q6ENU7.3|PSBE_SACOF RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Saccharum officinarum] >gi|60392969|sp|P69386.2|PSBE_WHEAT RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Triticum aestivum] >gi|60392970|sp|P69387.2|PSBE_SECCE RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V >gi|60392971|sp|P69388.2|PSBE_MAIZE RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Zea mays] >gi|60392973|sp|P69390.2|PSBE_HORVU RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Hordeum vulgare] >gi|75291221|sp|Q6L383.3|PSBE_SACHY RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Saccharum sp.] >gi|125964877|sp|A1EA25.1|PSBE_AGRST RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Agrostis stolonifera] >gi|125964917|sp|A1E9U1.1|PSBE_SORBI RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Sorghum bicolor] >gi|148887004|sp|P0C368.1|PSBE_ORYSA RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V >gi|148887005|sp|P0C369.1|PSBE_ORYSI RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Oryza sativa Indica Group] >gi|148887006|sp|P0C370.1|PSBE_ORYSJ RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Oryza sativa Japonica Group] >gi|12004|emb|CAA33965.1| PSII cytochrome b559 [Oryza sativa Japonica Group] >gi|12231|emb|CAA31698.1| psbE [Secale cereale] >gi|12339|emb|CAA27405.1| unnamed protein product [Triticum aestivum] >gi|14260|emb|CAA33294.1| cytochrome b-559 polypeptide [Triticum aestivum] >gi|336409|gb|AAA84044.1| cytochrome b-559 9.4 kD apoprotein (psbE) [Hordeum vulgare] >gi|336416|gb|AAA84048.1| cytochrome b-559 9.4 kDa protein (psbE) [Hordeum vulgare] >gi|342586|gb|AAA84478.1| cytochrome b559 alpha subunit [Zea mays] >gi|902238|emb|CAA60302.1| PSII cytochrome b559 [Zea mays] >gi|20161433|dbj|BAB90357.1| Chloroplast PSII cytochrome b559 (psbE) [Oryza sativa Japonica Group] >gi|21952823|dbj|BAC06239.1| PSII cytochrome b559 (psbE) [Oryza sativa Japonica Group] >gi|40253578|dbj|BAD05524.1| cytochrome b559 alpha chain [Oryza sativa Japonica Group] >gi|48478689|gb|AAT44709.1| cytochrome b559 alpha chain [Saccharum hybrid cultivar SP80-3280] >gi|49615013|dbj|BAD26796.1| PSII cytochrome b559 [Oryza nivara] >gi|49659528|dbj|BAD27309.1| PSII cytochrome b559 8kD subunit [Saccharum hybrid cultivar NCo 310] >gi|118201058|gb|ABK79429.1| photosystem II cytochrome b559 alpha subunit [Hordeum vulgare subsp. vulgare] >gi|118201143|gb|ABK79513.1| photosystem II cytochrome b559 alpha subunit [Sorghum bicolor] >gi|118201228|gb|ABK79597.1| photosystem II cytochrome b559 alpha subunit [Agrostis stolonifera] >gi|193075573|gb|ACF08656.1| PSII cytochrome b559 8kDa subunit (chloroplast) [Brachypodium distachyon] >gi|209361373|gb|ACI43288.1| photosystem II cytochrome b559 alpha subunit [Coix lacryma-jobi] >gi|246367083|gb|ACS94694.1| PsbE [Bambusa oldhamii] >gi|255040276|gb|ACT99936.1| photosystem II cytochrome b559 alpha subunit [Dendrocalamus latiflorus] >gi|307133903|gb|ADN32908.1| photosystem II cytochrome b559 alpha subunit [Phyllostachys nigra var. henonis] >gi|307697261|gb|ADN86085.1| photosystem II cytochrome b559 alpha subunit [Chasmanthium latifolium] >gi|309321634|gb|ADO65159.1| photosystem II cytochrome b559 alpha subunit [Acidosasa purpurea] >gi|309321718|gb|ADO65242.1| photosystem II cytochrome b559 alpha subunit [Ferrocalamus rimosivaginus] >gi|309321801|gb|ADO65324.1| photosystem II cytochrome b559 alpha subunit [Indocalamus longiauritus] >gi|309321885|gb|ADO65407.1| photosystem II cytochrome b559 alpha subunit [Phyllostachys edulis] >gi|309321970|gb|ADO65491.1| photosystem II cytochrome b559 alpha subunit [Bambusa emeiensis] >gi|319412335|gb|ADV41871.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Panicum virgatum] >gi|319412422|gb|ADV41957.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Panicum virgatum] >gi|336326855|gb|AEI53033.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Oryza meridionalis] >gi|336326931|gb|AEI53108.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Oryza rufipogon] >gi|336327009|gb|AEI53185.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Oryza rufipogon] >gi|346228320|gb|AEO21194.1| photosystem II cytochrome b559 alpha subunit [Leersia tisserantii] >gi|346228404|gb|AEO21277.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Phyllostachys propinqua] >gi|346228488|gb|AEO21360.1| photosystem II cytochrome b559 alpha subunit [Rhynchoryza subulata] >gi|353685070|gb|AER12835.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Oryza sativa Indica Group] >gi|353685158|gb|AER12922.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Oryza sativa Indica Group] >gi|374974885|gb|AFA27534.1| photosystem II cytochrome b559 alpha subunit [Thamnochortus insignis] >gi|384406868|gb|AFH89525.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Aegilops tauschii] >gi|394986508|gb|AFN42389.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Aegilops speltoides] >gi|410177782|gb|AFV62663.1| photosystem II cytochrome b559 alpha subunit [Festuca altissima] >gi|410177869|gb|AFV62749.1| photosystem II cytochrome b559 alpha subunit [Festuca ovina] >gi|413917709|gb|AFW57641.1| cytochrome b559 subunit alpha [Zea mays] >gi|414590288|tpg|DAA40859.1| TPA: cytochrome b559 subunit alpha [Zea mays] >gi|414879661|tpg|DAA56792.1| TPA: cytochrome b559 subunit alpha [Zea mays] >gi|441480267|gb|AGC38179.1| photosystem II protein V (chloroplast) [Arundinaria gigantea] >gi|473722901|gb|EMS44978.1| Cytochrome b559 subunit alpha [Triticum urartu] >gi|474005446|gb|EMS52410.1| Cytochrome b559 subunit alpha [Triticum urartu] >gi|511262242|gb|AGN72236.1| photosystem II protein V (chloroplast) [Arundinaria appalachiana] >gi|511262326|gb|AGN72319.1| photosystem II protein V (chloroplast) [Arundinaria tecta] >gi|521300968|gb|AGP50771.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Hordeum vulgare subsp. vulgare] >gi|521301046|gb|AGP50848.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Hordeum vulgare subsp. spontaneum] >gi|521301126|gb|AGP50927.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Hordeum vulgare subsp. spontaneum] >gi|521301206|gb|AGP51006.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Triticum monococcum] >gi|521301286|gb|AGP51085.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Secale cereale] >gi|521301363|gb|AGP51161.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Triticum monococcum subsp. aegilopoides] >gi|521301503|gb|AGP51299.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Triticum aestivum] >gi|540067318|gb|AGV02672.1| photosystem II cytochrome b559 alpha subunit (chloroplast) (chloroplast) [Zea mays subsp. mays] >gi|540067403|gb|AGV02756.1| photosystem II cytochrome b559 alpha subunit (chloroplast) (chloroplast) [Zea mays subsp. mays] >gi|545691490|gb|AGW46756.1| photosystem II cytochrome b559 alpha subunit (chloroplast) (chloroplast) [Neyraudia reynaudiana] >gi|554515570|gb|AGY92873.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Aegilops cylindrica] >gi|554515648|gb|AGY92950.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Aegilops geniculata] >gi|555298059|gb|AGZ13161.1| photosystem II cytochrome b559 alpha subunit [Setaria italica] >gi|555298156|gb|AGZ13256.1| photosystem II protein V [Olyra latifolia] >gi|555946005|gb|AGZ19231.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Oryza rufipogon] >gi|558614306|gb|AHA82316.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Phragmites australis] >gi|582041350|gb|AHI43060.1| photosystem II protein V [Deschampsia antarctica] >gi|589387884|gb|AHL16841.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Sorghum timorense] >gi|605059475|gb|AHV90341.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Setaria italica] >gi|629265481|emb|CCO06445.1| photosystem II cytochrome b559 alpha subunit (chloroplast) (chloroplast) [Lecomtella madagascariensis] >gi|631793332|gb|AHZ18231.1| photosystem II cytochrome b559 alpha subunit [Cenchrus americanus] >gi|634743476|gb|AHZ60727.1| photosystem II protein V [Oryza glaberrima] >gi|634743560|gb|AHZ60810.1| photosystem II cytochrome b559 alpha subunit [Digitaria exilis] >gi|657371739|gb|KEH17720.1| lumenal portion of cytochrome b559, alpha protein [Medicago truncatula] >gi|662117305|gb|AIE44591.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Oryza australiensis] >gi|225299|prf||1211325A cytochrome b559 >gi|226625|prf||1603356AY photosystem II cytochrome b559 >gi|226933|prf||1611459A cytochrome b-559)
BLAST of Medtr0002s0700.1 vs. NCBI nr
Match: gi|556927104|ref|YP_008757458.1| (cytochrome b559 subunit alpha (chloroplast) [Oryza rufipogon] >gi|42795499|gb|AAS46066.1| cytochrome b559 alpha chain [Oryza sativa Indica Group] >gi|42795566|gb|AAS46132.1| cytochrome b559 alpha chain [Oryza sativa Japonica Group] >gi|42795630|gb|AAS46195.1| cytochrome b559 alpha chain [Oryza sativa Japonica Group] >gi|290790587|gb|ADD62847.1| photosystem II cytochrome b559 alpha subunit [Oryza sativa Japonica Group] >gi|290790656|gb|ADD62915.1| photosystem II cytochrome b559 alpha subunit [Oryza meridionalis] >gi|290790725|gb|ADD62983.1| photosystem II cytochrome b559 alpha subunit [Oryza australiensis] >gi|290790794|gb|ADD63051.1| photosystem II cytochrome b559 alpha subunit [Potamophila parviflora] >gi|290790861|gb|ADD63117.1| photosystem II cytochrome b559 alpha subunit [Microlaena stipoides] >gi|552954496|gb|AGY48964.1| cytochrome b559 subunit alpha (chloroplast) [Oryza rufipogon])
BLAST of Medtr0002s0700.1 vs. NCBI nr
Match: gi|474162936|gb|EMS57323.1| (Cytochrome b559 subunit alpha [Triticum urartu])
BLAST of Medtr0002s0700.1 vs. NCBI nr
Match: gi|374974829|gb|AFA27506.1| (photosystem II cytochrome b559 alpha subunit, partial [Ecdeiocolea monostachya])
BLAST of Medtr0002s0700.1 vs. NCBI nr
Match: gi|441480351|gb|AGC38262.1| (photosystem II protein V (chloroplast) [Cryptochloa strictiflora])
BLAST of Medtr0002s0700.1 vs. NCBI nr
Match: gi|456061787|ref|YP_007475978.1| (photosystem II cytochrome b559 alpha subunit [Bismarckia nobilis] >gi|449326461|gb|AGE93043.1| photosystem II cytochrome b559 alpha subunit [Bismarckia nobilis])
BLAST of Medtr0002s0700.1 vs. NCBI nr
Match: gi|374974831|gb|AFA27507.1| (photosystem II cytochrome b559 alpha subunit, partial [Eleusine coracana])
BLAST of Medtr0002s0700.1 vs. NCBI nr
Match: gi|159106880|ref|YP_001531299.1| (psbE gene product (chloroplast) [Lolium perenne] >gi|255961285|ref|YP_002364515.2| photosystem II cytochrome b559 alpha subunit [Festuca arundinacea] >gi|427437088|ref|YP_007026655.1| photosystem II cytochrome b559 alpha subunit [Festuca pratensis] >gi|427437234|ref|YP_007026741.1| photosystem II cytochrome b559 alpha subunit [Lolium multiflorum] >gi|158934414|emb|CAO85992.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Lolium perenne] >gi|255926568|gb|ACJ70772.2| photosystem II cytochrome b559 alpha subunit [Festuca arundinacea] >gi|410177956|gb|AFV62835.1| photosystem II cytochrome b559 alpha subunit [Festuca pratensis] >gi|410178043|gb|AFV62921.1| photosystem II cytochrome b559 alpha subunit [Lolium multiflorum])
BLAST of Medtr0002s0700.1 vs. NCBI nr
Match: gi|116008999|gb|ABJ52168.1| (PsbE [Phyllostachys edulis])
BLAST of Medtr0002s0700.1 vs. NCBI nr
Match: gi|11497544|ref|NP_054952.1| (photosystem II protein V [Spinacia oleracea] >gi|28261734|ref|NP_783249.1| photosystem II protein V [Atropa belladonna] >gi|34500931|ref|NP_904116.1| photosystem II protein V [Amborella trichopoda] >gi|68164820|ref|YP_247616.1| photosystem II protein V [Cucumis sativus] >gi|91208919|ref|YP_538952.1| photosystem II protein V [Gossypium hirsutum] >gi|119368516|ref|YP_913204.1| PSII cytochrome b559 8kD subunit [Gossypium barbadense] >gi|149390285|ref|YP_001294115.1| photosystem II cytochrome b559 alpha subunit [Chloranthus spicatus] >gi|149390371|ref|YP_001294369.1| photosystem II protein V [Dioscorea elephantipes] >gi|164597827|ref|NP_084709.2| photosystem II protein V [Oenothera elata subsp. hookeri] >gi|169142727|ref|YP_001687154.1| cytochrome b559 alpha subunit [Oenothera argillicola] >gi|169142877|ref|YP_001687300.1| cytochrome b559 alpha subunit [Oenothera glazioviana] >gi|169142962|ref|YP_001687384.1| cytochrome b559 alpha subunit [Oenothera biennis] >gi|169143048|ref|YP_001687468.1| cytochrome b559 alpha subunit [Oenothera parviflora] >gi|189162288|ref|YP_001936534.1| photosystem II protein V [Fagopyrum esculentum subsp. ancestrale] >gi|289065106|ref|YP_003433992.1| photosystem II cytochrome b559 alpha subunit [Typha latifolia] >gi|295065744|ref|YP_003587684.1| photosystem II protein V [Anomochloa marantoidea] >gi|313199719|ref|YP_004021333.1| photosystem II cytochrome b559 alpha subunit [Theobroma cacao] >gi|325210947|ref|YP_004286021.1| photosystem II cytochrome b559 alpha subunit [Gossypium thurberi] >gi|346578208|ref|YP_004841800.1| photosystem II cytochrome b559 alpha subunit [Cucumis melo subsp. melo] >gi|372290948|ref|YP_005087710.1| photosystem II protein V (chloroplast) [Gossypium raimondii] >gi|372291049|ref|YP_005087806.1| photosystem II protein V (chloroplast) [Gossypium darwinii] >gi|372291403|ref|YP_005088297.1| photosystem II protein V (chloroplast) [Gossypium tomentosum] >gi|372291501|ref|YP_005088393.1| photosystem II protein V (chloroplast) [Gossypium herbaceum subsp. africanum] >gi|372291791|ref|YP_005088933.1| photosystem II protein V (chloroplast) [Gossypium mustelinum] >gi|372291875|ref|YP_005089016.1| photosystem II protein V (chloroplast) [Gossypium arboreum] >gi|383930481|ref|YP_005089969.1| psbE gene product (chloroplast) [Brassica napus] >gi|386800855|ref|YP_006303508.1| photosystem II protein V (chloroplast) [Gossypium gossypioides] >gi|394830644|ref|YP_006503294.1| photosystem II protein V (chloroplast) [Gossypium incanum] >gi|394830731|ref|YP_006503377.1| photosystem II protein V (chloroplast) [Gossypium somalense] >gi|394830817|ref|YP_006503460.1| photosystem II protein V (chloroplast) [Gossypium capitis-viridis] >gi|394830906|ref|YP_006503543.1| photosystem II protein V (chloroplast) [Gossypium areysianum] >gi|394830993|ref|YP_006503626.1| photosystem II protein V (chloroplast) [Gossypium robinsonii] >gi|428697639|ref|YP_007025913.1| photosystem II cytochrome b559 alpha subunit [Vaccinium macrocarpon] >gi|459014510|ref|YP_007507128.1| photosystem II protein V (chloroplast) [Salvia miltiorrhiza] >gi|501770871|ref|YP_007889878.1| photosystem II cytochrome b559 alpha subunit [Francoa sonchifolia] >gi|519704521|ref|YP_008082598.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Utricularia gibba] >gi|552541320|ref|YP_008592505.1| photosystem II protein V (chloroplast) [Andrographis paniculata] >gi|568244665|ref|YP_008963412.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Sedum sarmentosum] >gi|570700331|ref|YP_008993991.1| photosystem II protein V (chloroplast) [Pharus lappulaceus] >gi|570758897|ref|YP_008992481.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Gossypium anomalum] >gi|570758985|ref|YP_008992567.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Gossypium bickii] >gi|570759073|ref|YP_008992912.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Gossypium sturtianum] >gi|570759593|ref|YP_008992654.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Gossypium herbaceum] >gi|570759679|ref|YP_008992740.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Gossypium longicalyx] >gi|570879930|ref|YP_008992826.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Gossypium stocksii] >gi|570880033|ref|YP_008994306.1| photosystem II cytochrome b559 alpha subunit [Melianthus villosus] >gi|586929248|ref|YP_009002009.1| photosystem II protein V (chloroplast) [Puelia olyriformis] >gi|587005092|ref|YP_009002272.1| photosystem II protein V (chloroplast) [Pinguicula ehlersiae] >gi|590000432|ref|YP_009004061.1| photosystem II cytochrome b559 alpha subunit [Cucumis hystrix] >gi|595789697|ref|YP_009019905.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Azadirachta indica] >gi|651249286|ref|YP_009033902.1| photosystem II protein V [Dioscorea rotundata] >gi|658645671|ref|YP_009045583.1| photosystem II protein V (chloroplast) [Cypripedium macranthos] >gi|663060391|ref|YP_009046931.1| photosystem II protein V (chloroplast) [Raphanus sativus] >gi|31340254|sp|P59702.3|PSBE_ATRBE RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Atropa belladonna] >gi|60390482|sp|Q70XY9.3|PSBE_AMBTC RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Amborella trichopoda] >gi|60392965|sp|P69382.2|PSBE_BETVU RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V >gi|60392966|sp|P69383.2|PSBE_SPIOL RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Spinacia oleracea] >gi|75317265|sp|Q4VZH5.1|PSBE_CUCSA RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Cucumis sativus] >gi|94730454|sp|Q2L925.1|PSBE_GOSHI RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Gossypium hirsutum] >gi|114152861|sp|P56779.4|PSBE_ARATH RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Arabidopsis thaliana] >gi|125964890|sp|A0ZZ52.1|PSBE_GOSBA RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Gossypium barbadense] >gi|172045773|sp|Q9MTK5.4|PSBE_OENEH RecName: Full=Cytochrome b559 subunit alpha; AltName: Full=PSII reaction center subunit V (chloroplast) [Oenothera elata subsp. hookeri] >gi|343358|gb|AAA84628.1| apocytochrome b-559 [Spinacia oleracea] >gi|533298|dbj|BAA07218.1| PSII cytochrome b559 subunit [Beta vulgaris subsp. vulgaris] >gi|7636125|emb|CAB88745.1| PSII reaction centre subunit V (chloroplast) [Spinacia oleracea] >gi|20068348|emb|CAC88061.1| PSII reaction center subunit V [Atropa belladonna] >gi|31580952|dbj|BAC77579.1| PSII cytochrome b559 8 kDa subunit [Nicotiana tomentosiformis] >gi|34481646|emb|CAD45123.1| PSII reaction centre subunit V [Amborella trichopoda] >gi|67511415|emb|CAJ00775.1| cytochrome b559 alpha chain [Cucumis sativus] >gi|69217514|gb|AAZ04067.1| cytochrome b559 alpha chain [Typha latifolia] >gi|69217516|gb|AAZ04068.1| cytochrome b559 alpha chain [Yucca schidigera] >gi|74027118|gb|AAZ94668.1| PSII reaction center subunit V [Cucumis sativus] >gi|82581265|dbj|BAE48705.1| PSII cytochrome b559 subunit [Beta vulgaris] >gi|85687433|gb|ABC73645.1| photosystem II cytochrome b559 alpha subunit [Gossypium hirsutum] >gi|115432821|gb|ABI97434.1| photosystem II cytochrome b559 alpha subunit [Cucumis sativus] >gi|115498320|gb|ABI98762.1| photosystem II cytochrome b559 alpha subunit [Cucumis sativus] >gi|119224878|dbj|BAF41264.1| PSII cytochrome b559 8kD subunit [Gossypium barbadense] >gi|146744205|gb|ABQ43277.1| photosystem II cytochrome b559 alpha subunit [Chloranthus spicatus] >gi|148668063|gb|ABR01447.1| photosystem II cytochrome b559 alpha subunit [Dioscorea elephantipes] >gi|159792965|gb|ABW98721.1| cytochrome b559 alpha subunit [Oenothera argillicola] >gi|159793135|gb|ABW98889.1| cytochrome b559 alpha subunit [Oenothera biennis] >gi|159895489|gb|ABX10054.1| cytochrome b559 alpha subunit [Oenothera glazioviana] >gi|159895574|gb|ABX10138.1| cytochrome b559 alpha subunit [Oenothera parviflora] >gi|162423694|emb|CAB67174.2| cytochrome b559 alpha subunit [Oenothera elata subsp. hookeri] >gi|166065374|gb|ABY79749.1| photosystem II protein V [Fagopyrum esculentum subsp. ancestrale] >gi|218175491|gb|ACK75691.1| PsbE [Typha domingensis] >gi|251765268|gb|ACT15422.1| photosystem II protein V [Anomochloa marantoidea] >gi|254553659|gb|ACT67288.1| photosystem II cytochrome b559 alpha subunit [Joinvillea plicata] >gi|262400778|gb|ACY66267.1| photosystem II protein V [Brassica napus] >gi|281371789|gb|ADA63716.1| photosystem II cytochrome b559 alpha subunit [Typha latifolia] >gi|290488316|gb|ADD30542.1| photosystem II cytochrome b559 alpha subunit protein (chloroplast) [Antirrhinum majus] >gi|290488318|gb|ADD30543.1| photosystem II cytochrome b559 alpha subunit protein (chloroplast) [Aucuba japonica] >gi|290488324|gb|ADD30546.1| photosystem II cytochrome b559 alpha subunit protein (chloroplast) [Ilex cornuta] >gi|290488340|gb|ADD30554.1| photosystem II cytochrome b559 alpha subunit protein (chloroplast) [Berberidopsis corallina] >gi|290488352|gb|ADD30560.1| photosystem II cytochrome b559 alpha subunit protein (chloroplast) [Heuchera sanguinea] >gi|290488358|gb|ADD30563.1| photosystem II cytochrome b559 alpha subunit protein (chloroplast) [Plumbago auriculata] >gi|290488362|gb|ADD30565.1| photosystem II cytochrome b559 alpha subunit protein (chloroplast) [Staphylea colchica] >gi|290775809|gb|ADD62305.1| photosystem II cytochrome b559 alpha subunit [Gossypium thurberi] >gi|309321283|gb|ADO64826.1| photosystem II cytochrome b559 alpha subunit [Theobroma cacao] >gi|318084334|gb|ADV38810.1| photosystem II protein V (chloroplast) [Gossypium arboreum] >gi|318084417|gb|ADV38892.1| photosystem II protein V (chloroplast) [Gossypium darwinii] >gi|318084502|gb|ADV38976.1| photosystem II protein V (chloroplast) [Gossypium herbaceum subsp. africanum] >gi|318084586|gb|ADV39059.1| photosystem II protein V (chloroplast) [Gossypium mustelinum] >gi|318084666|gb|ADV39138.1| photosystem II protein V (chloroplast) [Gossypium raimondii] >gi|318084754|gb|ADV39225.1| photosystem II protein V (chloroplast) [Gossypium tomentosum] >gi|326457056|gb|ADZ74320.1| photosystem II cytochrome b559 alpha subunit [Gossypium anomalum] >gi|326457144|gb|ADZ74407.1| photosystem II cytochrome b559 alpha subunit [Gossypium bickii] >gi|326457232|gb|ADZ74494.1| photosystem II cytochrome b559 alpha subunit [Gossypium herbaceum] >gi|326457318|gb|ADZ74579.1| photosystem II cytochrome b559 alpha subunit [Gossypium longicalyx] >gi|326457405|gb|ADZ74665.1| photosystem II cytochrome b559 alpha subunit [Gossypium stocksii] >gi|326457493|gb|ADZ74752.1| photosystem II cytochrome b559 alpha subunit [Gossypium sturtianum] >gi|328924798|gb|ADO64907.2| photosystem II cytochrome b559 alpha subunit [Theobroma cacao] >gi|329317089|gb|AEB90448.1| photosystem II protein V (chloroplast) [Gossypium gossypioides] >gi|329317173|gb|AEB90531.1| photosystem II protein V (chloroplast) [Gossypium hirsutum] >gi|329317257|gb|AEB90614.1| photosystem II protein V (chloroplast) [Gossypium hirsutum] >gi|329317341|gb|AEB90697.1| photosystem II protein V (chloroplast) [Gossypium barbadense] >gi|329317425|gb|AEB90780.1| photosystem II protein V (chloroplast) [Gossypium barbadense] >gi|329317509|gb|AEB90863.1| photosystem II protein V (chloroplast) [Gossypium barbadense] >gi|335354349|gb|AEH42969.1| photosystem II protein V [Gossypium incanum] >gi|335354433|gb|AEH43052.1| photosystem II protein V [Gossypium somalense] >gi|335354517|gb|AEH43135.1| photosystem II protein V (chloroplast) [Gossypium capitis-viridis] >gi|335354601|gb|AEH43218.1| photosystem II protein V (chloroplast) [Gossypium areysianum] >gi|335354685|gb|AEH43301.1| photosystem II protein V [Gossypium robinsonii] >gi|337730888|gb|AEI70788.1| photosystem II cytochrome b559 alpha subunit [Puelia olyriformis] >gi|344030508|gb|AEM76909.1| photosystem II cytochrome b559 alpha subunit [Cucumis melo subsp. melo] >gi|371925953|gb|AEX57743.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Theobroma cacao] >gi|371926035|gb|AEX57824.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Theobroma cacao] >gi|371926117|gb|AEX57905.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Theobroma cacao] >gi|371926199|gb|AEX57986.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Theobroma cacao] >gi|371926281|gb|AEX58067.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Theobroma cacao] >gi|371926363|gb|AEX58148.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Theobroma cacao] >gi|371926445|gb|AEX58229.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Theobroma cacao] >gi|371926527|gb|AEX58310.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Theobroma cacao] >gi|371926609|gb|AEX58391.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Theobroma cacao] >gi|371926691|gb|AEX58472.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Theobroma grandiflorum] >gi|371926773|gb|AEX58553.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Theobroma cacao] >gi|372000497|gb|AEX65325.1| cytochrome b559 alpha subunit [Anredera baselloides] >gi|372000501|gb|AEX65327.1| cytochrome b559 alpha subunit [Didierea madagascariensis] >gi|372000503|gb|AEX65328.1| cytochrome b559 alpha subunit [Maihuenia poeppigii] >gi|372000505|gb|AEX65329.1| cytochrome b559 alpha subunit [Mollugo verticillata] >gi|372000509|gb|AEX65331.1| cytochrome b559 alpha subunit [Portulacaria afra] >gi|372000511|gb|AEX65332.1| cytochrome b559 alpha subunit [Pereskiopsis diguetii] >gi|372000513|gb|AEX65333.1| cytochrome b559 alpha subunit [Portulaca oleracea] >gi|372000517|gb|AEX65335.1| cytochrome b559 alpha subunit [Weingartia kargliana] >gi|372483866|gb|AEX95575.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Agapanthus africanus] >gi|372483868|gb|AEX95576.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Anemarrhena asphodeloides] >gi|372483870|gb|AEX95577.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Camassia scilloides] >gi|372483872|gb|AEX95578.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Echeandia sp. Steele 1101] >gi|372483874|gb|AEX95579.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Hosta ventricosa] >gi|372483876|gb|AEX95580.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Manfreda virginica] >gi|372483878|gb|AEX95581.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Polianthes sp. Pires 2011-05] >gi|372483884|gb|AEX95584.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Gilliesia graminea] >gi|372483886|gb|AEX95585.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Tulbaghia violacea] >gi|372483888|gb|AEX95586.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Amaryllis belladonna] >gi|372483890|gb|AEX95587.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Crinum asiaticum] >gi|372483892|gb|AEX95588.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Eucharis x grandiflora] >gi|372483894|gb|AEX95589.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Scadoxus cinnabarinus] >gi|372483898|gb|AEX95591.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Asparagus officinalis] >gi|372483900|gb|AEX95592.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Asparagus asparagoides] >gi|372483902|gb|AEX95593.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Hemiphylacus alatostylus] >gi|372483914|gb|AEX95599.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Phormium tenax] >gi|372483916|gb|AEX95600.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Bowiea volubilis] >gi|372483918|gb|AEX95601.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Drimia altissima] >gi|372483920|gb|AEX95602.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Ledebouria cordifolia] >gi|372483922|gb|AEX95603.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Ornithogalum tenuifolium] >gi|372483924|gb|AEX95604.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Oziroe biflora] >gi|372483928|gb|AEX95606.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Cordyline australis] >gi|372483930|gb|AEX95607.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Trichopetalum plumosum] >gi|372483934|gb|AEX95609.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Dasylirion wheeleri] >gi|372483936|gb|AEX95610.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Eriospermum cervicorne] >gi|372483938|gb|AEX95611.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Liriope spicata] >gi|372483940|gb|AEX95612.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Ophiopogon japonicus] >gi|372483942|gb|AEX95613.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Ruscus aculeatus] >gi|372483946|gb|AEX95615.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Maianthemum stellatum] >gi|372483948|gb|AEX95616.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Androstephium coeruleum] >gi|372483950|gb|AEX95617.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Brodiaea californica] >gi|372483952|gb|AEX95618.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Dichelostemma capitatum] >gi|372483954|gb|AEX95619.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Dichelostemma congestum] >gi|372483956|gb|AEX95620.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Dichelostemma ida-maia] >gi|372483958|gb|AEX95621.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Triteleia hyacinthina] >gi|372483960|gb|AEX95622.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Xanthorrhoea preissii] >gi|372483962|gb|AEX95623.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Xeronema callistemon] >gi|374093722|gb|AEY84158.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Vaccinium macrocarpon] >gi|374257057|gb|AEZ01443.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Japonolirion osense] >gi|374974805|gb|AFA27494.1| photosystem II cytochrome b559 alpha subunit [Agapanthus praecox] >gi|374974807|gb|AFA27495.1| photosystem II cytochrome b559 alpha subunit [Albuca kirkii] >gi|374974811|gb|AFA27497.1| photosystem II cytochrome b559 alpha subunit, partial [Asparagus officinalis] >gi|374974815|gb|AFA27499.1| photosystem II cytochrome b559 alpha subunit, partial [Brocchinia micrantha] >gi|374974821|gb|AFA27502.1| photosystem II cytochrome b559 alpha subunit, partial [Chlorophytum rhizopendulum] >gi|374974825|gb|AFA27504.1| photosystem II cytochrome b559 alpha subunit, partial [Cyperus alternifolius] >gi|374974835|gb|AFA27509.1| photosystem II cytochrome b559 alpha subunit, partial [Fosterella caulescens] >gi|374974839|gb|AFA27511.1| photosystem II cytochrome b559 alpha subunit, partial [Hesperaloe parviflora] >gi|374974841|gb|AFA27512.1| photosystem II cytochrome b559 alpha subunit, partial [Hosta ventricosa] >gi|374974845|gb|AFA27514.1| photosystem II cytochrome b559 alpha subunit [Joinvillea ascendens] >gi|374974847|gb|AFA27515.1| photosystem II cytochrome b559 alpha subunit [Juncus effusus] >gi|374974853|gb|AFA27518.1| photosystem II cytochrome b559 alpha subunit [Lomandra longifolia] >gi|374974857|gb|AFA27520.1| photosystem II cytochrome b559 alpha subunit, partial [Navia saxicola] >gi|374974861|gb|AFA27522.1| photosystem II cytochrome b559 alpha subunit, partial [Neoregelia carolinae] >gi|374974863|gb|AFA27523.1| photosystem II cytochrome b559 alpha subunit, partial [Nolina atopocarpa] >gi|374974867|gb|AFA27525.1| photosystem II cytochrome b559 alpha subunit, partial [Phormium tenax] >gi|374974869|gb|AFA27526.1| photosystem II cytochrome b559 alpha subunit, partial [Pitcairnia feliciana] >gi|374974871|gb|AFA27527.1| photosystem II cytochrome b559 alpha subunit, partial [Potarophytum riparium] >gi|374974873|gb|AFA27528.1| photosystem II cytochrome b559 alpha subunit, partial [Puya laxa] >gi|374974879|gb|AFA27531.1| photosystem II cytochrome b559 alpha subunit, partial [Sparganium eurycarpum] >gi|374974881|gb|AFA27532.1| photosystem II cytochrome b559 alpha subunit, partial [Streptochaeta angustifolia] >gi|385198150|gb|AFI44068.1| photosystem II cytochrome b559 alpha subunit [Vaccinium macrocarpon] >gi|386268382|gb|AFJ00488.1| photosystem II cytochrome b559 alpha subunit [Francoa sonchifolia] >gi|387135527|gb|AFJ53133.1| photosystem II protein V (chloroplast) [Punica granatum] >gi|387135536|gb|AFJ53141.1| photosystem II protein V (chloroplast) [Punica granatum] >gi|401879759|gb|AFQ30946.1| photosystem II protein V (chloroplast) [Salvia miltiorrhiza] >gi|402239138|gb|AFQ39425.1| photosystem II cytochrome b559 alpha subunit [Potentilla villosa] >gi|402797547|gb|AFQ99079.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Sedum sarmentosum] >gi|408903962|gb|AFU96565.1| PsbE, partial (chloroplast) [Galearia maingayi] >gi|408903998|gb|AFU96583.1| PsbE, partial (chloroplast) [Rhizophora mangle] >gi|410176171|gb|AFV61830.1| photosystem II protein V (chloroplast) [Origanum vulgare subsp. vulgare] >gi|449020275|gb|AGE65772.1| photosystem II protein V (chloroplast) [Pharus lappulaceus] >gi|469474019|gb|AGH33789.1| photosystem II protein V (chloroplast) [Puelia olyriformis] >gi|498921871|gb|AGL61092.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Utricularia gibba] >gi|527355156|gb|AGS13025.1| photosystem II cytochrome b559 alpha subunit [Melianthus villosus] >gi|532164853|gb|AGT79863.1| photosystem II protein V (chloroplast) [Andrographis paniculata] >gi|573014939|gb|AHF71524.1| cytochrome b559 alpha chain (chloroplast) [Acer buergerianum subsp. ningpoense] >gi|573015476|gb|AHF72055.1| cytochrome b559 alpha chain (chloroplast) [Rosa odorata var. gigantea] >gi|573461968|emb|CCQ71637.1| photosystem II protein V (chloroplast) [Salvia miltiorrhiza] >gi|575882154|emb|CDL78828.1| photosystem II protein V (chloroplast) [Pinguicula ehlersiae] >gi|576090079|gb|AHH24291.1| photosystem II protein E (chloroplast) [Japonolirion osense] >gi|576598296|gb|AHH30458.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Bartsia inaequalis] >gi|578888883|gb|AHI16766.1| photosystem II protein V (chloroplast) (chloroplast) [Cypripedium macranthos] >gi|584297198|gb|AHI87544.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Chionographis japonica] >gi|586598703|gb|AHJ61403.1| photosystem II cytochrome b559 alpha subunit [Cucumis hystrix] >gi|586947552|gb|AHJ91335.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Azadirachta indica] >gi|595645850|gb|AHM89303.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Lagenaria siceraria] >gi|595646091|gb|AHM89540.1| photosystem II cytochrome b559 alpha subunit (chloroplast) [Lagenaria siceraria] >gi|631793248|gb|AHZ18148.1| photosystem II protein V [Dioscorea rotundata] >gi|662020193|gb|AIE42483.1| photosystem II protein V (chloroplast) [Raphanus sativus])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0700.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|11466807|ref|NP_039403.1|4.423120e-52100.00photosystem II protein V [Oryza sativa Japonica Gr... [more]
gi|556927104|ref|YP_008757458.1|4.950760e-52100.00cytochrome b559 subunit alpha (chloroplast) [Oryza... [more]
gi|474162936|gb|EMS57323.1|6.546690e-5298.80Cytochrome b559 subunit alpha [Triticum urartu][more]
gi|374974829|gb|AFA27506.1|1.244810e-5198.80photosystem II cytochrome b559 alpha subunit, part... [more]
gi|441480351|gb|AGC38262.1|1.293480e-5198.80photosystem II protein V (chloroplast) [Cryptochlo... [more]
gi|456061787|ref|YP_007475978.1|1.465720e-5198.80photosystem II cytochrome b559 alpha subunit [Bism... [more]
gi|374974831|gb|AFA27507.1|2.290750e-5198.80photosystem II cytochrome b559 alpha subunit, part... [more]
gi|159106880|ref|YP_001531299.1|2.639150e-5198.80psbE gene product (chloroplast) [Lolium perenne] >... [more]
gi|116008999|gb|ABJ52168.1|2.860360e-51100.00PsbE [Phyllostachys edulis][more]
gi|11497544|ref|NP_054952.1|5.184420e-5198.80photosystem II protein V [Spinacia oleracea] >gi|2... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR006216Photosystem II cytochrome b559, conserved sitePROSITEPS00537CYTOCHROME_B559coord: 14..28
score
IPR006217Photosystem II cytochrome b559, alpha subunitPIRPIRSF000036Cytochrome b559, alpha subunitcoord: 1..83
score: 9.2
IPR006217Photosystem II cytochrome b559, alpha subunitTIGRFAMsTIGR01332cyt_b559_alpha: cytochrome b559, alphacoord: 2..81
score: 1.4

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0700.1 ID=Medtr0002s0700.1|Name=Medtr0002s0700.1|organism=Medicago truncatula|type=mRNA|length=252bp
ATGTCTGGAAGCACGGGAGAACGTTCTTTTGCTGATATTATTACCAGTAT
TCGATACTGGGTTATTCATAGCATTACTATACCTTCCCTATTCATTGCGG
GTTGGTTATTTGTCAGTACGGGTTTAGCTTATGACGTGTTTGGAAGTCCT
AGGCCAAACGAATATTTCACGGAAAGCCGACAAGGAATTCCGTTAATAAC
CGACCGTTTTGATTCTTTAGAACAACTCGATGAATTTAGTAGATCCTTTT
AG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR006216Photosystem II cytochrome b559, conserved site
IPR006217Photosystem II cytochrome b559, alpha subunit
Vocabulary: Cellular Component
TermDefinition
GO:0009539photosystem II reaction center
GO:0016021integral component of membrane
GO:0030096plasma membrane-derived thylakoid photosystem II
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0009536plastid
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0009767photosynthetic electron transport chain
Vocabulary: Molecular Function
TermDefinition
GO:0020037heme binding