Overview
NameMedtr0002s0660.1
Unique NameMedtr0002s0660.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1440
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0015977 carbon fixation
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
cellular_component GO:0009536 plastid
molecular_function GO:0005488 binding
molecular_function GO:0000287 magnesium ion binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
molecular_function GO:0016984 ribulose-bisphosphate carboxylase activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00016.15255058-255984154-4621-309569.51.7e-175569.79.7e-172
PF02788.11254659-25503621-1461-126207.45.5e-66208.22.1e-62

Homology
BLAST of Medtr0002s0660.1 vs. NCBI nr
Match: gi|118430396|ref|YP_874661.1| (ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum vulgare subsp. vulgare] >gi|126302590|sp|P05698.2|RBL_HORVU RecName: Full=Ribulose bisphosphate carboxylase large chain; Short=RuBisCO large subunit; Flags: Precursor (chloroplast) [Hordeum vulgare] >gi|31087903|gb|AAN27986.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum vulgare subsp. spontaneum] >gi|31087909|gb|AAN27989.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum vulgare subsp. vulgare] >gi|61378651|gb|AAX44970.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum vulgare subsp. spontaneum] >gi|118201050|gb|ABK79421.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum vulgare subsp. vulgare] >gi|521300960|gb|AGP50763.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Hordeum vulgare subsp. vulgare] >gi|521301037|gb|AGP50839.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Hordeum vulgare subsp. spontaneum] >gi|521301118|gb|AGP50919.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Hordeum vulgare subsp. spontaneum])
BLAST of Medtr0002s0660.1 vs. NCBI nr
Match: gi|31087905|gb|AAN27987.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum bulbosum])
BLAST of Medtr0002s0660.1 vs. NCBI nr
Match: gi|61378660|gb|AAX44976.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Peridictyon sanctum])
BLAST of Medtr0002s0660.1 vs. NCBI nr
Match: gi|31087879|gb|AAN27974.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum comosum])
BLAST of Medtr0002s0660.1 vs. NCBI nr
Match: gi|61378666|gb|AAX44980.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Psathyrostachys fragilis subsp. fragilis])
BLAST of Medtr0002s0660.1 vs. NCBI nr
Match: gi|31087917|gb|AAN27993.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Psathyrostachys fragilis subsp. fragilis] >gi|51859665|gb|AAU11112.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Psathyrostachys fragilis subsp. villosus])
BLAST of Medtr0002s0660.1 vs. NCBI nr
Match: gi|14017580|ref|NP_114267.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Triticum aestivum] >gi|533310209|ref|YP_008474399.1| ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Aegilops speltoides] >gi|132065|sp|P11383.2|RBL_WHEAT RecName: Full=Ribulose bisphosphate carboxylase large chain; Short=RuBisCO large subunit; Flags: Precursor (chloroplast) [Triticum aestivum] >gi|344053|dbj|BAA00146.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (H-type) [Triticum aestivum] >gi|13928213|dbj|BAB47042.1| RuBisCO large subunit [Triticum aestivum] >gi|61378606|gb|AAX44940.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Australopyrum pectinatum] >gi|169666638|gb|ACA63887.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Triticum aestivum] >gi|394986500|gb|AFN42381.1| ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Aegilops speltoides] >gi|521301495|gb|AGP51291.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Triticum aestivum])
BLAST of Medtr0002s0660.1 vs. NCBI nr
Match: gi|525778513|ref|YP_008239101.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) (chloroplast) [Triticum monococcum] >gi|525782224|ref|YP_008239180.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) (chloroplast) [Secale cereale] >gi|525782303|ref|YP_008239257.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) (chloroplast) [Triticum urartu] >gi|533310113|ref|YP_008474308.1| ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Aegilops tauschii] >gi|568245004|ref|YP_008963912.1| ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) (chloroplast) [Aegilops geniculata] >gi|568247002|ref|YP_008963835.1| ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) (chloroplast) [Aegilops cylindrica] >gi|31087843|gb|AAN27956.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. gussoneanum] >gi|31087845|gb|AAN27957.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. gussoneanum] >gi|31087847|gb|AAN27958.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. gussoneanum] >gi|31087849|gb|AAN27959.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. gussoneanum] >gi|31087851|gb|AAN27960.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. gussoneanum] >gi|31087853|gb|AAN27961.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. gussoneanum] >gi|31087855|gb|AAN27962.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. gussoneanum] >gi|31087857|gb|AAN27963.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. gussoneanum] >gi|31087859|gb|AAN27964.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. gussoneanum] >gi|31087861|gb|AAN27965.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. gussoneanum] >gi|31087863|gb|AAN27966.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum marinum subsp. gussoneanum] >gi|31087875|gb|AAN27972.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum flexuosum] >gi|31087881|gb|AAN27975.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum euclaston] >gi|31087885|gb|AAN27977.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum patagonicum subsp. patagonicum] >gi|31087901|gb|AAN27985.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum pusillum] >gi|61378594|gb|AAX44932.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Bromus arvensis] >gi|61378618|gb|AAX44948.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Triticum monococcum] >gi|61378627|gb|AAX44954.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Eremopyrum triticeum] >gi|61378633|gb|AAX44958.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Henrardia persica] >gi|61378639|gb|AAX44962.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Hordeum brachyantherum subsp. californicum] >gi|61378657|gb|AAX44974.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Aegilops tauschii] >gi|61378663|gb|AAX44978.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Crithopsis delileana] >gi|307696888|gb|ADN85899.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Leymus erianthus] >gi|333069941|gb|AEF13572.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Hordeum pubiflorum] >gi|384406860|gb|AFH89517.1| ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Aegilops tauschii] >gi|521301198|gb|AGP50998.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Triticum monococcum] >gi|521301278|gb|AGP51077.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Secale cereale] >gi|521301355|gb|AGP51153.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Triticum monococcum subsp. aegilopoides] >gi|521301434|gb|AGP51231.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Triticum urartu] >gi|554515562|gb|AGY92865.1| ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Aegilops cylindrica] >gi|554515640|gb|AGY92942.1| ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (chloroplast) [Aegilops geniculata])
BLAST of Medtr0002s0660.1 vs. NCBI nr
Match: gi|61378609|gb|AAX44942.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Australopyrum retrofractum])
BLAST of Medtr0002s0660.1 vs. NCBI nr
Match: gi|51859663|gb|AAU11111.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Psathyrostachys fragilis subsp. villosus])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0660.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|118430396|ref|YP_874661.1|0.000000e+099.79ribulose 1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|31087905|gb|AAN27987.1|0.000000e+099.58ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|61378660|gb|AAX44976.1|0.000000e+099.58ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|31087879|gb|AAN27974.1|0.000000e+099.37ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|61378666|gb|AAX44980.1|0.000000e+099.37ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|31087917|gb|AAN27993.1|0.000000e+099.16ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|14017580|ref|NP_114267.1|0.000000e+099.58ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|525778513|ref|YP_008239101.1|0.000000e+099.58ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|61378609|gb|AAX44942.1|0.000000e+099.16ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|51859663|gb|AAU11111.1|0.000000e+098.96ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000685Ribulose bisphosphate carboxylase, large subunit, C-terminalGENE3D3.20.20.110no descriptioncoord: 149..462
score: 8.2e
IPR000685Ribulose bisphosphate carboxylase, large subunit, C-terminalSUPERFAMILY51649RuBisCo, C-terminal domaincoord: 150..475
score: 7.3e
IPR017443Ribulose bisphosphate carboxylase, large subunit, ferrodoxin-like N-terminalGENE3D3.30.70.150no descriptioncoord: 22..148
score: 1
IPR017443Ribulose bisphosphate carboxylase, large subunit, ferrodoxin-like N-terminalSUPERFAMILY54966RuBisCO, large subunit, small (N-terminal) domaincoord: 7..149
score: 3.8
IPR020878Ribulose bisphosphate carboxylase, large chain, active sitePROSITEPS00157RUBISCO_LARGEcoord: 196..204
score
NoneNo IPR availableSEGsegsegcoord: 46..60
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0660.1 ID=Medtr0002s0660.1|Name=Medtr0002s0660.1|organism=Medicago truncatula|type=mRNA|length=1440bp
ATGTCACCACAAACAGAAACTAAAGCAGGTGTTGGATTTCAAGCTGGTGT
TAAAGATTATAAATTGACTTACTACACCCCAGAGTATGAAACTAAGGATA
CTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAGCCTGGGGTTCCGCCC
GAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGAC
AACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGAT
GCTATCACATCGAGCCTGTTGCTGGGGAAGACAGCCAATGGATCTGTTAT
GTAGCTTATCCATTAGACCTATTTGAGGAGGGTTCCGTTACTAACATGTT
TACTTCCATTGTGGGTAACGTATTTGGGTTCAAAGCCCTACGTGCTCTAC
GTTTGGAGGATCTACGAATTCCCCCTACTTATTCAAAAACTTTCCAAGGC
CCGCCTCATGGTATCCAAGTTGAAAGAGATAAGTTGAACAAGTATGGCCG
TCCTTTATTGGGATGTACTATTAAACCTAAATTGGGTTTATCCGCTAAAA
ATTACGGTAGAGCAGTTTATGAATGTCTACGTGGTGGACTTGATTTTACC
AAAGATGATGAAAACGTAAACTCACAACCATTTATGCGCTGGAGAGACCG
TTTTGTCTTTTGTGCCGAAGCTATTTATAAATCACAGGCCGAAACCGGTG
AAATCAAGGGGCATTACTTGAATGCGACTGCGGGTACATGTGAAGAAATG
ATTAAGAGAGCTGTATTTGCGAGAGAATTAGGGGTTCCTATTGTAATGCA
TGACTACTTAACCGGGGGATTCACCGCAAATACTACTTTGGCTCACTATT
GCCGCGACAATGGCTTACTTCTTCACATTCACCGTGCAATGCATGCAGTT
ATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTATTAGCTAAAGC
ATTGCGTATGTCTGGGGGAGATCATATCCACTCCGGTACAGTAGTAGGTA
AGTTAGAAGGGGAACGCGAAATGACTTTAGGTTTTGTTGATTTATTGCGC
GATGATTTTATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAGGA
CTGGGTATCCATGCCAGGTGTTATACCGGTAGCTTCAGGTGGTATTCATG
TTTGGCATATGCCAGCTCTGACCGAAATCTTTGGGGACGATTCTGTATTA
CAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGGAATGCACCTGGTGC
AGCAGCTAATCGAGTGGCTTTAGAAGCTTGTGTACAAGCTCGTAACGAAG
GGCGTGATCTTGCTCGCGAAGGTAATGAAATTATCCGAGCAGCTTGCAAA
TGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATT
CGAGTTCGAGCCGGTAGATACTATCGATAAGAAGGTCTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000685Ribulose bisphosphate carboxylase, large subunit, C-terminal
IPR017443Ribulose bisphosphate carboxylase, large subunit, ferrodoxin-like N-terminal
IPR020878Ribulose bisphosphate carboxylase, large chain, active site
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0000287magnesium ion binding
GO:0016984ribulose-bisphosphate carboxylase activity
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0009536plastid
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0015977carbon fixation