Overview
NameMedtr0002s0440.1
Unique NameMedtr0002s0440.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length213
Homology
BLAST of Medtr0002s0440.1 vs. NCBI nr
Match: gi|46805113|dbj|BAD17352.1| (putative Hooker's evening primrose chloroplast hypothetical 8.4 kDa protein in ycf9-trnS intergenic region (ORF75) [Oryza sativa Japonica Group])
BLAST of Medtr0002s0440.1 vs. NCBI nr
Match: gi|134093195|ref|YP_001109497.1| (hypothetical protein Poptr_cp018 [Populus trichocarpa] >gi|133712057|gb|ABO36700.1| conserved hypothetical protein [Populus trichocarpa])
BLAST of Medtr0002s0440.1 vs. NCBI nr
Match: gi|388492680|gb|AFK34406.1| (unknown [Lotus japonicus])
BLAST of Medtr0002s0440.1 vs. NCBI nr
Match: gi|7484687|pir||T08999 (hypothetical protein - spinach chloroplast)
BLAST of Medtr0002s0440.1 vs. NCBI nr
Match: gi|168069650|ref|XP_001786528.1| (predicted protein [Physcomitrella patens] >gi|162661089|gb|EDQ48661.1| predicted protein [Physcomitrella patens])
BLAST of Medtr0002s0440.1 vs. NCBI nr
Match: gi|145408564|ref|YP_001152188.1| (ORF83b [Pinus koraiensis] >gi|145048813|gb|ABP35431.1| ORF83b [Pinus koraiensis])
BLAST of Medtr0002s0440.1 vs. NCBI nr
Match: gi|224106710|ref|XP_002314256.1| (predicted protein [Populus trichocarpa])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0440.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 7
Match NameE-valueIdentityDescription
gi|46805113|dbj|BAD17352.1|7.929680e-4195.71putative Hooker's evening primrose chloroplast hyp... [more]
gi|134093195|ref|YP_001109497.1|3.942790e-3282.86hypothetical protein Poptr_cp018 [Populus trichoca... [more]
gi|388492680|gb|AFK34406.1|1.021620e-3182.86unknown [Lotus japonicus][more]
gi|7484687|pir||T089993.765930e-3182.09hypothetical protein - spinach chloroplast[more]
gi|168069650|ref|XP_001786528.1|1.456520e-2569.70predicted protein [Physcomitrella patens] >gi|1626... [more]
gi|145408564|ref|YP_001152188.1|1.605110e-2568.66ORF83b [Pinus koraiensis] >gi|145048813|gb|ABP3543... [more]
gi|224106710|ref|XP_002314256.1|3.758300e-2570.59predicted protein [Populus trichocarpa][more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0440.1 ID=Medtr0002s0440.1|Name=Medtr0002s0440.1|organism=Medicago truncatula|type=mRNA|length=213bp
ATGAGAGAATTCAGAATAGCTACGAGAAAGACTAGTCCAATCCATAATGA
TGTACCGGAAAATACAACATTTTTATTATTTGACCAACCATCAGGAGAAG
CAAATACAAGGGGTACACTAATTACTAAGACTGAGGAAGTCGCAATTAAT
GCAAAAACAGCTAATTGGAAAGCAATAGTCATATTTCTAATCCTCCAAGC
TACCATCAAATAA
back to top