Overview
NameMedtr0002s0360.1
Unique NameMedtr0002s0360.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length651
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0040007 growth
biological_process GO:0006412 translation
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0015934 large ribosomal subunit
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
cellular_component GO:0005840 ribosome
cellular_component GO:0015935 small ribosomal subunit
molecular_function GO:0003723 RNA binding
molecular_function GO:0005488 binding
molecular_function GO:1901363 heterocyclic compound binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0003676 nucleic acid binding
molecular_function GO:0097159 organic cyclic compound binding
molecular_function GO:0003735 structural constituent of ribosome
molecular_function GO:0016740 transferase activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00203.16199656-199865135-20411-80107.72.2e-35108.39.7e-32
PF03947.13199254-1995921-11318-130162.94e-52163.41.9e-48

Homology
BLAST of Medtr0002s0360.1 vs. NCBI nr
Match: gi|474428044|gb|EMS67832.1| (50S ribosomal protein L2, chloroplastic [Triticum urartu])
BLAST of Medtr0002s0360.1 vs. NCBI nr
Match: gi|474361023|gb|EMS63307.1| (50S ribosomal protein L2, chloroplastic [Triticum urartu])
BLAST of Medtr0002s0360.1 vs. NCBI nr
Match: gi|413939050|gb|AFW73601.1| (30S ribosomal protein S19 [Zea mays])
BLAST of Medtr0002s0360.1 vs. NCBI nr
Match: gi|460365367|ref|XP_004228574.1| (PREDICTED: LOW QUALITY PROTEIN: 50S ribosomal protein L2, chloroplastic-like [Solanum lycopersicum])
BLAST of Medtr0002s0360.1 vs. NCBI nr
Match: gi|218192996|gb|EEC75423.1| (hypothetical protein OsI_11930 [Oryza sativa Indica Group])
BLAST of Medtr0002s0360.1 vs. NCBI nr
Match: gi|307697285|gb|ADN86097.1| (photosystem I subunit VIII [Chasmanthium latifolium])
BLAST of Medtr0002s0360.1 vs. NCBI nr
Match: gi|374277633|gb|AEZ03739.1| (hypothetical protein (mitochondrion) [Oryza sativa Indica Group] >gi|374277721|gb|AEZ03826.1| hypothetical protein (mitochondrion) [Oryza sativa Indica Group])
BLAST of Medtr0002s0360.1 vs. NCBI nr
Match: gi|34394232|dbj|BAC84684.1| (ribosomal protein L2, chloroplast [Oryza sativa Japonica Group])
BLAST of Medtr0002s0360.1 vs. NCBI nr
Match: gi|218193190|gb|EEC75617.1| (hypothetical protein OsI_12334 [Oryza sativa Indica Group] >gi|555946029|gb|AGZ19255.1| ribosomal protein L2 (chloroplast) [Oryza rufipogon] >gi|555946056|gb|AGZ19282.1| ribosomal protein L2 (chloroplast) [Oryza rufipogon])
BLAST of Medtr0002s0360.1 vs. NCBI nr
Match: gi|413917691|gb|AFW57623.1| (hypothetical protein ZEAMMB73_132644, partial [Zea mays])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0360.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|474428044|gb|EMS67832.1|1.328850e-15195.1550S ribosomal protein L2, chloroplastic [Triticum ... [more]
gi|474361023|gb|EMS63307.1|3.186350e-15194.7150S ribosomal protein L2, chloroplastic [Triticum ... [more]
gi|413939050|gb|AFW73601.1|8.314800e-13289.5030S ribosomal protein S19 [Zea mays][more]
gi|460365367|ref|XP_004228574.1|1.160510e-10575.46PREDICTED: LOW QUALITY PROTEIN: 50S ribosomal prot... [more]
gi|218192996|gb|EEC75423.1|2.413520e-8899.25hypothetical protein OsI_11930 [Oryza sativa Indic... [more]
gi|307697285|gb|ADN86097.1|3.296820e-8899.25photosystem I subunit VIII [Chasmanthium latifoliu... [more]
gi|374277633|gb|AEZ03739.1|3.401330e-8899.25hypothetical protein (mitochondrion) [Oryza sativa... [more]
gi|34394232|dbj|BAC84684.1|4.108870e-8899.25ribosomal protein L2, chloroplast [Oryza sativa Ja... [more]
gi|218193190|gb|EEC75617.1|5.205050e-8899.25hypothetical protein OsI_12334 [Oryza sativa Indic... [more]
gi|413917691|gb|AFW57623.1|2.810630e-8798.50hypothetical protein ZEAMMB73_132644, partial [Zea... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR002222Ribosomal protein S19/S15PRINTSPR00975RIBOSOMALS19coord: 155..174
score: 3.5e-22coord: 175..187
score: 3.5e-22coord: 187..202
score: 3.5
IPR005732Ribosomal protein S19, bacterial-typeTIGRFAMsTIGR01050rpsS_bact: ribosomal protein S19coord: 119..216
score: 2.8
IPR005880Ribosomal protein L2, bacterial-typeTIGRFAMsTIGR01171rplB_bact: ribosomal protein L2coord: 2..136
score: 4.8
IPR008991Translation protein SH3-likeSUPERFAMILY50104Translation proteins SH3-like domaincoord: 2..129
score: 5
IPR014722Translation protein SH3-like, subgroupGENE3D2.30.30.30no descriptioncoord: 2..53
score: 4.4
IPR014726Ribosomal protein L2, domain 3GENE3D4.10.950.10no descriptioncoord: 56..133
score: 1.2
IPR020934Ribosomal protein S19 conserved sitePROSITEPS00323RIBOSOMAL_S19coord: 175..199
score
IPR022671Ribosomal protein L2, conserved sitePROSITEPS00467RIBOSOMAL_L2coord: 78..89
score
IPR023575Ribosomal protein S19, superfamilyGENE3D3.30.860.10no descriptioncoord: 135..208
score: 1.5
IPR023575Ribosomal protein S19, superfamilySUPERFAMILY54570Ribosomal protein S19coord: 117..207
score: 5.3
NoneNo IPR availableSEGsegsegcoord: 8..20
score: NAcoord: 52..62
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0360.1 ID=Medtr0002s0360.1|Name=Medtr0002s0360.1|organism=Medicago truncatula|type=mRNA|length=651bp
ATGCATAACATAGAAATCACACGTGGAAGGGGTGGGCAATTAGCTAGAGC
AGCAGGTGCTGTAGCGAAACTCATTGCAAAAGAGGGTAAATCGGCCACTT
TAAGATTACCATCTGGGGAGGTCCGTTTAGTATCCCAAAATTGCTTAGCA
ACAGTCGGACAAGTGGGTAATGTTGGGGTGAACCAAAAAAGTTTGGGTAG
AGCCGGATCTAAGTGTTGGCTAGGTAAACGCCCCGTAGTAAGAGGGGTAG
TTATGAACCCTGTGGACCACCCCCATGGGGGCGGTGAAGGGAAAGCTCCC
ATTGGTAGAAAAAAACCCACAACCCCTTGGGGTTATCCTGCGCTTGGAAG
AAGAACTAGGAAAAGGAAAAAATATAGCGATAGTTTTATTCTTCGTCGCC
CTCATCATTTATTGGCAAAGATAGAAAAGGTCAATATGAAGGAGGAGAAA
GAAACAATAGTAACGTGGTCCCGGGCATCTAGCATTCTACCCACAATGGT
TGGCCATACAATTGCGATTCATAATGGAAAGGAACATATACCTATTTACA
TAACAAATCCTATGGTAGGTCGCAAATTGGGAGAATTCGTGCCTACTCGG
CATTTTACGAGTTATGAAAATGCAAGAAAGGATACTAAATCTCGTCGTTA
A
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR002222Ribosomal protein S19/S15
IPR005732Ribosomal protein S19, bacterial-type
IPR005880Ribosomal protein L2, bacterial-type
IPR008991Translation protein SH3-like
IPR014722Translation protein SH3-like, subgroup
IPR014726Ribosomal protein L2, domain 3
IPR020934Ribosomal protein S19 conserved site
IPR022671Ribosomal protein L2, conserved site
IPR023575Ribosomal protein S19, superfamily
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0003735structural constituent of ribosome
GO:0003723RNA binding
GO:0016740transferase activity
GO:0003674molecular_function
GO:0003676nucleic acid binding
GO:0005488binding
GO:0097159organic cyclic compound binding
GO:1901363heterocyclic compound binding
Vocabulary: Cellular Component
TermDefinition
GO:0005840ribosome
GO:0015935small ribosomal subunit
GO:0015934large ribosomal subunit
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005634nucleus
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0006412translation
GO:0040007growth
GO:0008150biological_process