Overview
NameMedtr0002s0310.1
Unique NameMedtr0002s0310.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1242
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0040007 growth
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
cellular_component GO:0009536 plastid
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00361.15193200-193691163-326109-269133.45.5e-43224.21.5e-66

Homology
BLAST of Medtr0002s0310.1 vs. NCBI nr
Match: gi|474361019|gb|EMS63303.1| (NAD(P)H-quinone oxidoreductase subunit 2 B, chloroplastic [Triticum urartu])
BLAST of Medtr0002s0310.1 vs. NCBI nr
Match: gi|474303941|gb|EMS61695.1| (NAD(P)H-quinone oxidoreductase subunit 2 B, chloroplastic [Triticum urartu] >gi|474379604|gb|EMS64457.1| NAD(P)H-quinone oxidoreductase subunit 2 B, chloroplastic [Triticum urartu])
BLAST of Medtr0002s0310.1 vs. NCBI nr
Match: gi|473889192|gb|EMS48461.1| (NAD(P)H-quinone oxidoreductase subunit 2 B, chloroplastic [Triticum urartu])
BLAST of Medtr0002s0310.1 vs. NCBI nr
Match: gi|149275504|gb|ABR23085.1| (NADH dehydrogenase subunit B [Tradescantia ohiensis])
BLAST of Medtr0002s0310.1 vs. NCBI nr
Match: gi|340807197|gb|AEK71787.1| (NADH-plastoquinone oxidoreductase subunit 2 [Tradescantia ohiensis] >gi|376011498|gb|AFB18510.1| NADH-plastoquinone oxidoreductase subunit 2, partial [Tradescantia ohiensis])
BLAST of Medtr0002s0310.1 vs. NCBI nr
Match: gi|376011442|gb|AFB18483.1| (NADH-plastoquinone oxidoreductase subunit 2, partial [Eleusine coracana])
BLAST of Medtr0002s0310.1 vs. NCBI nr
Match: gi|376011461|gb|AFB18492.1| (NADH-plastoquinone oxidoreductase subunit 2, partial [Lilium superbum])
BLAST of Medtr0002s0310.1 vs. NCBI nr
Match: gi|34394231|dbj|BAC84683.1| (NADH dehydrogenase ND2, chloroplast [Oryza sativa Japonica Group])
BLAST of Medtr0002s0310.1 vs. NCBI nr
Match: gi|460365359|ref|XP_004228570.1| (PREDICTED: NAD(P)H-quinone oxidoreductase subunit 2 A, chloroplastic-like [Solanum lycopersicum])
BLAST of Medtr0002s0310.1 vs. NCBI nr
Match: gi|376011415|gb|AFB18470.1| (NADH-plastoquinone oxidoreductase subunit 2, partial [Abolboda macrostachya])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0310.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|474361019|gb|EMS63303.1|0.000000e+095.16NAD(P)H-quinone oxidoreductase subunit 2 B, chloro... [more]
gi|474303941|gb|EMS61695.1|0.000000e+095.40NAD(P)H-quinone oxidoreductase subunit 2 B, chloro... [more]
gi|473889192|gb|EMS48461.1|0.000000e+095.16NAD(P)H-quinone oxidoreductase subunit 2 B, chloro... [more]
gi|149275504|gb|ABR23085.1|0.000000e+090.80NADH dehydrogenase subunit B [Tradescantia ohiensi... [more]
gi|340807197|gb|AEK71787.1|0.000000e+090.80NADH-plastoquinone oxidoreductase subunit 2 [Trade... [more]
gi|376011442|gb|AFB18483.1|0.000000e+092.49NADH-plastoquinone oxidoreductase subunit 2, parti... [more]
gi|376011461|gb|AFB18492.1|0.000000e+093.95NADH-plastoquinone oxidoreductase subunit 2, parti... [more]
gi|34394231|dbj|BAC84683.1|0.000000e+093.70NADH dehydrogenase ND2, chloroplast [Oryza sativa ... [more]
gi|460365359|ref|XP_004228570.1|0.000000e+092.11PREDICTED: NAD(P)H-quinone oxidoreductase subunit ... [more]
gi|376011415|gb|AFB18470.1|0.000000e+090.80NADH-plastoquinone oxidoreductase subunit 2, parti... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 172..184
score: NAcoord: 229..245
score: NAcoord: 295..318
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0310.1 ID=Medtr0002s0310.1|Name=Medtr0002s0310.1|organism=Medicago truncatula|type=mRNA|length=1242bp
ATGGCTATAACAGAGTTTCTGTTATTCGTATTAACAGCTACTCTAGGGGG
AATGTTTTTATGTGGTGCTAACGATTTAATAACTATCTTTGTAGCTCCAG
AATGTTTCAGTTTATGTTCCTACCTATTGTCTGGATATACCAAGAGAGAT
CTACGGTCTAATGAGGCTACTATGAAATATTTACTCATGGGTGGTGCAAG
CTCTTCTATTCTGGTTCATGGTTTCTCTTGGCTATATGGTTCATCTGGGG
GGGAGATCGAGCTTCAAGAAATTGTGAACGGTCTTATCAATACACAAATG
TATAACTCCCCTGGAATTTCAATTGCGCTTATATCCATCACTGTAGGACT
TGGGTTCAAGCTTTCCCCAGCCCCTTTTCATCAATGGACTCCTGACGTCT
ACGAAGGAGTGTGGTTCGTTCGACAAATTCCTACCTCTATATCTATCTCT
GAGAAAGAAGCGAGGAATCCTCTTTTCGACTCTGACTCCCCCACTCCAGT
CGTTGCTTTTCTTTCTGTTACTTCGAAAGTAGCTGCTTCAGCTTCAGCCA
CGCGAATTCTCGATATTCCTTTTTATTTCTCATCAAACGAATGGCATCTT
CTTCTGGAAATCCTAGCTATTCTTAGCATGATTTTGGGGAATCTCCTTGC
TATTACTCAAACAAGCATGAAACGTATGCTTGCATATTCGTCCATAGGGC
AAATCGGATATGTAATTATTGGAATAATTGTTGGAGACTCAAATGATGGA
TATGCAAGCATGATAACTTATATGCTGTTCTATATCTCCATGAATCTAGG
AACTTTTGCTTGCATTGTATTATTTGGTCTACGTACCGGAACTGATAACA
TTCGAGATTATGCAGGATTATACATTAAAGATCCTTTTTTGGCTCTCTCT
TTAGCCCTATGTCTCTTATCCCTAGGAGGCCTTCCTCCACTAGCAGGTTT
CTTCGGAAAACTCTATCTATTCTGGTGTGGATGGCAAGCAGGCCTATATT
TCTTGGTTTCAATAGGACTCCTTACGAGCGTTCTTTCTATCTACTATTAT
CTAAAAATAATCAAGTTATTAATGACTGGACGAAACCAAGAAATAACCCC
TTATGTGCGAAATTATAGAAGATCCCCTTTAAGATCAAACAATTCCATCG
AATTGAGTATGACTGTATGTGTGATAGCATCTACTATACCAGGAATATCA
ATGAACCCCATTCTTGCAATTGCTCAGGATACCCTCTTTTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0009536plastid
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0040007growth
GO:0008150biological_process