Overview
NameMedtr0002s0300.1
Unique NameMedtr0002s0300.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length399
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0040007 growth
biological_process GO:0006412 translation
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005739 mitochondrion
cellular_component GO:0043226 organelle
cellular_component GO:0005840 ribosome
cellular_component GO:0015935 small ribosomal subunit
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
molecular_function GO:0003735 structural constituent of ribosome
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00177.16191650-1920242-12625-148151.95.8e-49152.07.2e-45

Homology
BLAST of Medtr0002s0300.1 vs. NCBI nr
Match: gi|11467245|ref|NP_043077.1| (ribosomal protein S7 [Zea mays] >gi|11467269|ref|NP_043101.1| ribosomal protein S7 [Zea mays] >gi|48478721|ref|YP_024328.1| ribosomal protein S7 [Saccharum hybrid cultivar SP-80-3280] >gi|48478744|ref|YP_024352.1| ribosomal protein S7 [Saccharum hybrid cultivar SP-80-3280] >gi|50812582|ref|YP_054684.1| ribosomal protein S7 [Saccharum hybrid cultivar NCo 310] >gi|50812608|ref|YP_054709.1| ribosomal protein S7 [Saccharum hybrid cultivar NCo 310] >gi|94502707|ref|YP_588377.1| ribosomal protein S7 [Zea mays subsp. mays] >gi|118430346|ref|YP_874781.1| ribosomal protein S7 [Agrostis stolonifera] >gi|118430362|ref|YP_874795.1| ribosomal protein S7 [Agrostis stolonifera] >gi|118430431|ref|YP_874697.1| ribosomal protein S7 [Hordeum vulgare subsp. vulgare] >gi|118430446|ref|YP_874710.1| ribosomal protein S7 [Hordeum vulgare subsp. vulgare] >gi|118614536|ref|YP_899452.1| ribosomal protein S7 [Sorghum bicolor] >gi|118614551|ref|YP_899465.1| ribosomal protein S7 [Sorghum bicolor] >gi|159106908|ref|YP_001531326.1| rps7 gene product (chloroplast) [Lolium perenne] >gi|159106922|ref|YP_001531340.1| rps7 gene product (chloroplast) [Lolium perenne] >gi|194033191|ref|YP_002000530.1| ribosomal protein S7 [Brachypodium distachyon] >gi|194033204|ref|YP_002000543.1| ribosomal protein S7 [Brachypodium distachyon] >gi|218176285|ref|YP_002364542.1| ribosomal protein S7 [Festuca arundinacea] >gi|218176301|ref|YP_002364557.1| ribosomal protein S7 [Festuca arundinacea] >gi|253729599|ref|YP_003029783.1| ribosomal protein S7 [Bambusa oldhamii] >gi|253729611|ref|YP_003029797.1| ribosomal protein S7 [Bambusa oldhamii] >gi|255961425|ref|YP_003097619.1| ribosomal protein S7 [Dendrocalamus latiflorus] >gi|255961439|ref|YP_003097635.1| ribosomal protein S7 [Dendrocalamus latiflorus] >gi|260677462|ref|YP_003208239.1| ribosomal protein S7 [Coix lacryma-jobi] >gi|260677476|ref|YP_003208262.1| ribosomal protein S7 [Coix lacryma-jobi] >gi|339906496|ref|YP_004733288.1| ribosomal protein S7 [Indocalamus longiauritus] >gi|339906509|ref|YP_004733301.1| ribosomal protein S7 [Indocalamus longiauritus] >gi|340034069|ref|YP_004733622.1| ribosomal protein S7 [Phyllostachys edulis] >gi|340034083|ref|YP_004733637.1| ribosomal protein S7 [Phyllostachys edulis] >gi|340034241|ref|YP_004733804.1| ribosomal protein S7 [Acidosasa purpurea] >gi|340034254|ref|YP_004733817.1| ribosomal protein S7 [Acidosasa purpurea] >gi|340034409|ref|YP_004734022.1| ribosomal protein S7 [Phyllostachys nigra var. henonis] >gi|340034422|ref|YP_004734037.1| ribosomal protein S7 [Phyllostachys nigra var. henonis] >gi|340034494|ref|YP_004734145.1| ribosomal protein S7 [Bambusa emeiensis] >gi|340034508|ref|YP_004734160.1| ribosomal protein S7 [Bambusa emeiensis] >gi|340034580|ref|YP_004734229.1| ribosomal protein S7 [Ferrocalamus rimosivaginus] >gi|340034595|ref|YP_004734244.1| ribosomal protein S7 [Ferrocalamus rimosivaginus] >gi|345895262|ref|YP_004841993.1| ribosomal protein S7 [Panicum virgatum] >gi|345895277|ref|YP_004842008.1| ribosomal protein S7 [Panicum virgatum] >gi|374249395|ref|YP_005088577.1| rps7 gene product (chloroplast) [Phyllostachys propinqua] >gi|374249408|ref|YP_005088590.1| rps7 gene product (chloroplast) [Phyllostachys propinqua] >gi|426406683|ref|YP_007026597.1| ribosomal protein S7 [Festuca ovina] >gi|426406698|ref|YP_007026613.1| ribosomal protein S7 [Festuca ovina] >gi|427437019|ref|YP_007026511.1| ribosomal protein S7 [Festuca altissima] >gi|427437034|ref|YP_007026527.1| ribosomal protein S7 [Festuca altissima] >gi|427437116|ref|YP_007026683.1| ribosomal protein S7 [Festuca pratensis] >gi|427437131|ref|YP_007026699.1| ribosomal protein S7 [Festuca pratensis] >gi|427437262|ref|YP_007026769.1| ribosomal protein S7 [Lolium multiflorum] >gi|427437277|ref|YP_007026785.1| ribosomal protein S7 [Lolium multiflorum] >gi|452849526|ref|YP_007475184.1| ribosomal protein S7 (chloroplast) [Arundinaria gigantea] >gi|452849539|ref|YP_007475197.1| ribosomal protein S7 (chloroplast) [Arundinaria gigantea] >gi|511347618|ref|YP_008080540.1| ribosomal protein S7 (chloroplast) [Pharus latifolius] >gi|511347631|ref|YP_008080553.1| ribosomal protein S7 (chloroplast) [Pharus latifolius] >gi|525778551|ref|YP_008239138.1| ribosomal protein S7 (chloroplast) (chloroplast) [Triticum monococcum] >gi|525782259|ref|YP_008239215.1| ribosomal protein S7 (chloroplast) (chloroplast) [Secale cereale] >gi|525782321|ref|YP_008239275.1| ribosomal protein S7 (chloroplast) (chloroplast) [Triticum urartu] >gi|533310151|ref|YP_008474345.1| ribosomal protein S7 (chloroplast) [Aegilops tauschii] >gi|533310246|ref|YP_008474436.1| ribosomal protein S7 (chloroplast) [Aegilops speltoides] >gi|558603715|ref|YP_008815795.1| ribosomal protein S7 [Setaria italica] >gi|558603728|ref|YP_008815808.1| ribosomal protein S7 [Setaria italica] >gi|563354824|ref|YP_008855135.1| ribosomal protein S7 (chloroplast) [Phragmites australis] >gi|563354839|ref|YP_008855150.1| ribosomal protein S7 (chloroplast) [Phragmites australis] >gi|568245042|ref|YP_008963950.1| ribosomal protein S7 (chloroplast) (chloroplast) [Aegilops geniculata] >gi|568247038|ref|YP_008963871.1| ribosomal protein S7 (chloroplast) (chloroplast) [Aegilops cylindrica] >gi|570700358|ref|YP_008994020.1| ribosomal protein S7 (chloroplast) [Pharus lappulaceus] >gi|570700371|ref|YP_008994033.1| ribosomal protein S7 (chloroplast) [Pharus lappulaceus] >gi|586929278|ref|YP_009002039.1| ribosomal protein S7 (chloroplast) [Puelia olyriformis] >gi|586929291|ref|YP_009002052.1| ribosomal protein S7 (chloroplast) [Puelia olyriformis] >gi|589229866|ref|YP_009003873.1| ribosomal protein S7 [Deschampsia antarctica] >gi|589229882|ref|YP_009003889.1| ribosomal protein S7 [Deschampsia antarctica] >gi|595789898|ref|YP_009020182.1| ribosomal protein S7 (chloroplast) [Sorghum timorense] >gi|595789911|ref|YP_009020195.1| ribosomal protein S7 (chloroplast) [Sorghum timorense] >gi|608787602|ref|YP_009024299.1| ribosomal protein S7 (chloroplast) [Arundinaria appalachiana] >gi|608787615|ref|YP_009024312.1| ribosomal protein S7 (chloroplast) [Arundinaria appalachiana] >gi|608787686|ref|YP_009024382.1| ribosomal protein S7 (chloroplast) [Arundinaria tecta] >gi|608787698|ref|YP_009024394.1| ribosomal protein S7 (chloroplast) [Arundinaria tecta] >gi|649132408|ref|YP_009034014.1| ribosomal protein S7 [Cenchrus americanus] >gi|649132426|ref|YP_009034032.1| ribosomal protein S7 [Cenchrus americanus] >gi|649132636|ref|YP_009034224.1| ribosomal protein S7 [Digitaria exilis] >gi|649132651|ref|YP_009034239.1| ribosomal protein S7 [Digitaria exilis] >gi|651424285|ref|YP_009040450.1| ribosomal protein S7 (chloroplast) (chloroplast) [Neyraudia reynaudiana] >gi|651424301|ref|YP_009040465.1| ribosomal protein S7 (chloroplast) (chloroplast) [Neyraudia reynaudiana] >gi|662020726|ref|YP_009029915.1| ribosomal protein S7 (chloroplast) [Lecomtella madagascariensis] >gi|662020741|ref|YP_009029930.1| ribosomal protein S7 (chloroplast) [Lecomtella madagascariensis] >gi|1173275|sp|P12339.2|RR7_MAIZE RecName: Full=30S ribosomal protein S7, chloroplastic (chloroplast) [Zea mays] >gi|62287253|sp|Q6ENQ9.1|RR7_SACOF RecName: Full=30S ribosomal protein S7, chloroplastic (chloroplast) [Saccharum officinarum] >gi|75126321|sp|Q6L3C6.1|RR7_SACHY RecName: Full=30S ribosomal protein S7, chloroplastic (chloroplast) [Saccharum sp.] >gi|125987759|sp|A1EA53.1|RR7_AGRST RecName: Full=30S ribosomal protein S7, chloroplastic (chloroplast) [Agrostis stolonifera] >gi|125987762|sp|A1E9W9.1|RR7_SORBI RecName: Full=30S ribosomal protein S7, chloroplastic (chloroplast) [Sorghum bicolor] >gi|205831442|sp|A1E9N5.1|RR7_HORVU RecName: Full=30S ribosomal protein S7, chloroplastic (chloroplast) [Hordeum vulgare] >gi|205831452|sp|A8Y9D1.1|RR7_LOLPR RecName: Full=30S ribosomal protein S7, chloroplastic (chloroplast) [Lolium perenne] >gi|902274|emb|CAA60339.1| ribosomal protein S7 [Zea mays] >gi|902298|emb|CAA60362.1| ribosomal protein S7 [Zea mays] >gi|40795146|gb|AAR91190.1| ribosomal protein S7 (mitochondrion) [Zea mays] >gi|48478623|gb|AAT44643.1| ribosomal protein S7 [Saccharum hybrid cultivar SP80-3280] >gi|48478646|gb|AAT44666.1| ribosomal protein S7 [Saccharum hybrid cultivar SP80-3280] >gi|49659566|dbj|BAD27347.1| ribosomal protein S7 [Saccharum hybrid cultivar NCo 310] >gi|49659592|dbj|BAD27373.1| ribosomal protein S7 [Saccharum hybrid cultivar NCo 310] >gi|118201085|gb|ABK79456.1| ribosomal protein S7 [Hordeum vulgare subsp. vulgare] >gi|118201100|gb|ABK79471.1| ribosomal protein S7 [Hordeum vulgare subsp. vulgare] >gi|118201170|gb|ABK79540.1| ribosomal protein S7 [Sorghum bicolor] >gi|118201185|gb|ABK79555.1| ribosomal protein S7 [Sorghum bicolor] >gi|118201255|gb|ABK79624.1| ribosomal protein S7 [Agrostis stolonifera] >gi|118201271|gb|ABK79640.1| ribosomal protein S7 [Agrostis stolonifera] >gi|149275535|gb|ABR23101.1| ribosomal protein S7 [Chasmanthium latifolium] >gi|149275539|gb|ABR23104.1| ribosomal protein S7 [Aristida adscensionis] >gi|149275543|gb|ABR23107.1| ribosomal protein S7 [Bouteloua curtipendula] >gi|149275551|gb|ABR23113.1| ribosomal protein S7 [Phragmites australis] >gi|149275555|gb|ABR23116.1| ribosomal protein S7 [Brachyelytrum aristosum] >gi|149275559|gb|ABR23119.1| ribosomal protein S7 [Pseudosasa japonica] >gi|149275563|gb|ABR23122.1| ribosomal protein S7 [Pharus lappulaceus] >gi|158934442|emb|CAO86020.1| ribosomal protein S7 (chloroplast) [Lolium perenne] >gi|158934456|emb|CAO86034.1| ribosomal protein S7 (chloroplast) [Lolium perenne] >gi|193075599|gb|ACF08682.1| ribosomal protein S7 (chloroplast) [Brachypodium distachyon] >gi|193075612|gb|ACF08695.1| ribosomal protein S7 (chloroplast) [Brachypodium distachyon] >gi|195613694|gb|ACG28677.1| 40S ribosomal protein S5 [Zea mays] >gi|195615276|gb|ACG29468.1| 40S ribosomal protein S5 [Zea mays] >gi|195616576|gb|ACG30118.1| 40S ribosomal protein S5 [Zea mays] >gi|209361400|gb|ACI43315.1| ribosomal protein S7 [Coix lacryma-jobi] >gi|209361414|gb|ACI43329.1| ribosomal protein S7 [Coix lacryma-jobi] >gi|215882369|gb|ACJ70799.1| ribosomal protein S7 [Festuca arundinacea] >gi|215882385|gb|ACJ70815.1| ribosomal protein S7 [Festuca arundinacea] >gi|246367109|gb|ACS94720.1| ribosomal protein S7 [Bambusa oldhamii] >gi|246367121|gb|ACS94732.1| ribosomal protein S7 [Bambusa oldhamii] >gi|255040302|gb|ACT99962.1| ribosomal protein S7 [Dendrocalamus latiflorus] >gi|255040316|gb|ACT99976.1| ribosomal protein S7 [Dendrocalamus latiflorus] >gi|307133930|gb|ADN32935.1| ribosomal protein S7 [Phyllostachys nigra var. henonis] >gi|307133943|gb|ADN32948.1| ribosomal protein S7 [Phyllostachys nigra var. henonis] >gi|309321661|gb|ADO65186.1| ribosomal protein S7 [Acidosasa purpurea] >gi|309321674|gb|ADO65199.1| ribosomal protein S7 [Acidosasa purpurea] >gi|309321745|gb|ADO65269.1| ribosomal protein S7 [Ferrocalamus rimosivaginus] >gi|309321760|gb|ADO65284.1| ribosomal protein S7 [Ferrocalamus rimosivaginus] >gi|309321829|gb|ADO65352.1| ribosomal protein S7 [Indocalamus longiauritus] >gi|309321842|gb|ADO65365.1| ribosomal protein S7 [Indocalamus longiauritus] >gi|309321911|gb|ADO65433.1| ribosomal protein S7 [Phyllostachys edulis] >gi|309321925|gb|ADO65447.1| ribosomal protein S7 [Phyllostachys edulis] >gi|309321997|gb|ADO65518.1| ribosomal protein S7 [Bambusa emeiensis] >gi|309322011|gb|ADO65532.1| ribosomal protein S7 [Bambusa emeiensis] >gi|319412364|gb|ADV41900.1| ribosomal protein S7 (chloroplast) [Panicum virgatum] >gi|319412379|gb|ADV41915.1| ribosomal protein S7 (chloroplast) [Panicum virgatum] >gi|319412450|gb|ADV41985.1| ribosomal protein S7 (chloroplast) [Panicum virgatum] >gi|319412465|gb|ADV42000.1| ribosomal protein S7 (chloroplast) [Panicum virgatum] >gi|326511413|dbj|BAJ87720.1| predicted protein [Hordeum vulgare subsp. vulgare] >gi|326555089|gb|ADZ93766.1| ribosomal protein S7 [Puelia olyriformis] >gi|336280839|gb|AEI29127.1| ribosomal protein S7 (chloroplast) [Pharus latifolius] >gi|336280852|gb|AEI29140.1| ribosomal protein S7 (chloroplast) [Pharus latifolius] >gi|337730956|gb|AEI70822.1| ribosomal protein S7 [Puelia olyriformis] >gi|346228432|gb|AEO21305.1| ribosomal protein S7 (chloroplast) [Phyllostachys propinqua] >gi|346228445|gb|AEO21318.1| ribosomal protein S7 (chloroplast) [Phyllostachys propinqua] >gi|381353716|gb|AFG25690.1| ribosomal protein S7, partial [Eleusine coracana] >gi|384406898|gb|AFH89555.1| ribosomal protein S7 (chloroplast) [Aegilops tauschii] >gi|394986537|gb|AFN42418.1| ribosomal protein S7 (chloroplast) [Aegilops speltoides] >gi|410177810|gb|AFV62691.1| ribosomal protein S7 [Festuca altissima] >gi|410177825|gb|AFV62706.1| ribosomal protein S7 [Festuca altissima] >gi|410177897|gb|AFV62777.1| ribosomal protein S7 [Festuca ovina] >gi|410177912|gb|AFV62792.1| ribosomal protein S7 [Festuca ovina] >gi|410177984|gb|AFV62863.1| ribosomal protein S7 [Festuca pratensis] >gi|410177999|gb|AFV62878.1| ribosomal protein S7 [Festuca pratensis] >gi|410178071|gb|AFV62949.1| ribosomal protein S7 [Lolium multiflorum] >gi|410178086|gb|AFV62964.1| ribosomal protein S7 [Lolium multiflorum] >gi|441480294|gb|AGC38206.1| ribosomal protein S7 (chloroplast) [Arundinaria gigantea] >gi|441480307|gb|AGC38219.1| ribosomal protein S7 (chloroplast) [Arundinaria gigantea] >gi|449020302|gb|AGE65799.1| ribosomal protein S7 (chloroplast) [Pharus lappulaceus] >gi|449020315|gb|AGE65812.1| ribosomal protein S7 (chloroplast) [Pharus lappulaceus] >gi|469474049|gb|AGH33819.1| ribosomal protein S7 (chloroplast) [Puelia olyriformis] >gi|469474062|gb|AGH33832.1| ribosomal protein S7 (chloroplast) [Puelia olyriformis] >gi|474299208|gb|EMS61552.1| 30S ribosomal protein S7, chloroplastic [Triticum urartu] >gi|474379603|gb|EMS64456.1| 30S ribosomal protein S7, chloroplastic [Triticum urartu] >gi|511262270|gb|AGN72264.1| ribosomal protein S7 (chloroplast) [Arundinaria appalachiana] >gi|511262283|gb|AGN72277.1| ribosomal protein S7 (chloroplast) [Arundinaria appalachiana] >gi|511262354|gb|AGN72347.1| ribosomal protein S7 (chloroplast) [Arundinaria tecta] >gi|511262366|gb|AGN72359.1| ribosomal protein S7 (chloroplast) [Arundinaria tecta] >gi|521300996|gb|AGP50799.1| ribosomal protein S7 (chloroplast) [Hordeum vulgare subsp. vulgare] >gi|521301074|gb|AGP50876.1| ribosomal protein S7 (chloroplast) [Hordeum vulgare subsp. spontaneum] >gi|521301236|gb|AGP51036.1| ribosomal protein S7 (chloroplast) [Triticum monococcum] >gi|521301313|gb|AGP51112.1| ribosomal protein S7 (chloroplast) [Secale cereale] >gi|521301452|gb|AGP51249.1| ribosomal protein S7 (chloroplast) [Triticum urartu] >gi|521301532|gb|AGP51328.1| ribosomal protein S7 (chloroplast) [Triticum aestivum] >gi|540067345|gb|AGV02699.1| ribosomal protein S7 (chloroplast) (chloroplast) [Zea mays subsp. mays] >gi|540067362|gb|AGV02716.1| ribosomal protein S7 (chloroplast) (chloroplast) [Zea mays subsp. mays] >gi|540067430|gb|AGV02783.1| ribosomal protein S7 (chloroplast) (chloroplast) [Zea mays subsp. mays] >gi|540067447|gb|AGV02800.1| ribosomal protein S7 (chloroplast) (chloroplast) [Zea mays subsp. mays] >gi|545691518|gb|AGW46784.1| ribosomal protein S7 (chloroplast) (chloroplast) [Neyraudia reynaudiana] >gi|545691534|gb|AGW46800.1| ribosomal protein S7 (chloroplast) (chloroplast) [Neyraudia reynaudiana] >gi|554515598|gb|AGY92901.1| ribosomal protein S7 (chloroplast) [Aegilops cylindrica] >gi|554515678|gb|AGY92980.1| ribosomal protein S7 (chloroplast) [Aegilops geniculata] >gi|555298087|gb|AGZ13189.1| ribosomal protein S7 [Setaria italica] >gi|555298100|gb|AGZ13202.1| ribosomal protein S7 [Setaria italica] >gi|558614334|gb|AHA82344.1| ribosomal protein S7 (chloroplast) [Phragmites australis] >gi|558614349|gb|AHA82359.1| ribosomal protein S7 (chloroplast) [Phragmites australis] >gi|582041378|gb|AHI43088.1| ribosomal protein S7 [Deschampsia antarctica] >gi|582041394|gb|AHI43104.1| ribosomal protein S7 [Deschampsia antarctica] >gi|589387912|gb|AHL16869.1| ribosomal protein S7 (chloroplast) [Sorghum timorense] >gi|589387925|gb|AHL16882.1| ribosomal protein S7 (chloroplast) [Sorghum timorense] >gi|605059505|gb|AHV90371.1| ribosomal protein S7 (chloroplast) [Setaria italica] >gi|605059520|gb|AHV90386.1| ribosomal protein S7 (chloroplast) [Setaria italica] >gi|629265510|emb|CCO06474.1| ribosomal protein S7 (chloroplast) (chloroplast) [Lecomtella madagascariensis] >gi|629265525|emb|CCO06489.1| ribosomal protein S7 (chloroplast) (chloroplast) [Lecomtella madagascariensis] >gi|631793361|gb|AHZ18260.1| ribosomal protein S7 [Cenchrus americanus] >gi|631793379|gb|AHZ18278.1| ribosomal protein S7 [Cenchrus americanus] >gi|634743587|gb|AHZ60837.1| ribosomal protein S7 [Digitaria exilis] >gi|634743602|gb|AHZ60852.1| ribosomal protein S7 [Digitaria exilis])
BLAST of Medtr0002s0300.1 vs. NCBI nr
Match: gi|290790879|gb|ADD63135.1| (ribosomal protein S7 [Microlaena stipoides] >gi|290790893|gb|ADD63149.1| ribosomal protein S7 [Microlaena stipoides])
BLAST of Medtr0002s0300.1 vs. NCBI nr
Match: gi|552740|gb|AAA85360.1| (ribosomal protein S7 (chloroplast) [Zea mays])
BLAST of Medtr0002s0300.1 vs. NCBI nr
Match: gi|42795519|gb|AAS46086.1| (ribosomal protein S7 [Oryza sativa Indica Group] >gi|42795532|gb|AAS46099.1| ribosomal protein S7 [Oryza sativa Indica Group] >gi|42795585|gb|AAS46151.1| ribosomal protein S7 [Oryza sativa Japonica Group] >gi|42795598|gb|AAS46164.1| ribosomal protein S7 [Oryza sativa Japonica Group] >gi|42795649|gb|AAS46214.1| ribosomal protein S7 [Oryza sativa Japonica Group] >gi|42795662|gb|AAS46227.1| ribosomal protein S7 [Oryza sativa Japonica Group] >gi|290790606|gb|ADD62866.1| ribosomal protein S7 [Oryza sativa Japonica Group] >gi|290790620|gb|ADD62880.1| ribosomal protein S7 [Oryza sativa Japonica Group] >gi|290790675|gb|ADD62934.1| ribosomal protein S7 [Oryza meridionalis] >gi|290790689|gb|ADD62948.1| ribosomal protein S7 [Oryza meridionalis] >gi|290790744|gb|ADD63002.1| ribosomal protein S7 [Oryza australiensis] >gi|290790758|gb|ADD63016.1| ribosomal protein S7 [Oryza australiensis] >gi|290790812|gb|ADD63069.1| ribosomal protein S7 [Potamophila parviflora] >gi|290790826|gb|ADD63083.1| ribosomal protein S7 [Potamophila parviflora])
BLAST of Medtr0002s0300.1 vs. NCBI nr
Match: gi|357111582|ref|XP_003557591.1| (PREDICTED: 30S ribosomal protein S7, chloroplastic-like [Brachypodium distachyon])
BLAST of Medtr0002s0300.1 vs. NCBI nr
Match: gi|11466836|ref|NP_039433.1| (ribosomal protein S7 [Oryza sativa Japonica Group] >gi|11466861|ref|NP_039458.1| ribosomal protein S7 [Oryza sativa Japonica Group] >gi|14017616|ref|NP_114302.1| ribosomal protein S7 [Triticum aestivum] >gi|14017631|ref|NP_114316.1| ribosomal protein S7 [Triticum aestivum] >gi|50234024|ref|YP_052802.1| ribosomal protein S7 [Oryza nivara] >gi|50234053|ref|YP_052830.1| ribosomal protein S7 [Oryza nivara] >gi|112113313|ref|YP_654246.2| ribosomal protein S7 [Oryza sativa Indica Group] >gi|112113314|ref|YP_654259.2| ribosomal protein S7 [Oryza sativa Indica Group] >gi|374249311|ref|YP_005088054.1| rps7 gene product [Leersia tisserantii] >gi|374249324|ref|YP_005088067.1| rps7 gene product [Leersia tisserantii] >gi|374249664|ref|YP_005089191.1| rps7 gene product [Rhynchoryza subulata] >gi|374249677|ref|YP_005089204.1| rps7 gene product [Rhynchoryza subulata] >gi|378758454|ref|YP_005296458.1| rps7 gene product (chloroplast) [Oryza meridionalis] >gi|378758468|ref|YP_005296472.1| rps7 gene product (chloroplast) [Oryza meridionalis] >gi|386799210|ref|YP_006280799.1| rps7 gene product (chloroplast) [Oryza rufipogon] >gi|386799226|ref|YP_006280815.1| rps7 gene product (chloroplast) [Oryza rufipogon] >gi|556927135|ref|YP_008757489.1| 30S ribosomal protein S7 (chloroplast) [Oryza rufipogon] >gi|556927167|ref|YP_008757521.1| 30S ribosomal protein S7 (chloroplast) [Oryza rufipogon] >gi|649132527|ref|YP_009034141.1| ribosomal protein S7 [Oryza glaberrima] >gi|649132540|ref|YP_009034154.1| ribosomal protein S7 [Oryza glaberrima] >gi|51338631|sp|P62733.1|RR7_WHEAT RecName: Full=30S ribosomal protein S7, chloroplastic (chloroplast) [Triticum aestivum] >gi|62287251|sp|Q6ENC1.1|RR7_ORYNI RecName: Full=30S ribosomal protein S7, chloroplastic (chloroplast) [Oryza nivara] >gi|148840867|sp|P0C489.1|RR7_ORYSA RecName: Full=30S ribosomal protein S7, chloroplastic >gi|148840868|sp|P0C490.1|RR7_ORYSI RecName: Full=30S ribosomal protein S7, chloroplastic (chloroplast) [Oryza sativa Indica Group] >gi|148840869|sp|P0C491.1|RR7_ORYSJ RecName: Full=30S ribosomal protein S7, chloroplastic (chloroplast) [Oryza sativa Japonica Group] >gi|12037|emb|CAA33942.1| ribosomal protein S7 [Oryza sativa Japonica Group] >gi|12065|emb|CAA33919.1| ribosomal protein S7 [Oryza sativa Japonica Group] >gi|13928249|dbj|BAB47078.1| ribosomal protein S7 [Triticum aestivum] >gi|13928264|dbj|BAB47093.1| ribosomal protein S7 [Triticum aestivum] >gi|34394230|dbj|BAC84682.1| ribosomal protein S7, chloroplast [Oryza sativa Japonica Group] >gi|40253565|dbj|BAD05511.1| ribosomal protein S7 [Oryza sativa Japonica Group] >gi|49615048|dbj|BAD26831.1| ribosomal protein S7 [Oryza nivara] >gi|49615077|dbj|BAD26860.1| ribosomal protein S7 [Oryza nivara] >gi|336326878|gb|AEI53056.1| ribosomal protein S7 (chloroplast) [Oryza meridionalis] >gi|336326892|gb|AEI53070.1| ribosomal protein S7 (chloroplast) [Oryza meridionalis] >gi|336326954|gb|AEI53131.1| ribosomal protein S7 (chloroplast) [Oryza rufipogon] >gi|336326970|gb|AEI53147.1| ribosomal protein S7 (chloroplast) [Oryza rufipogon] >gi|336327032|gb|AEI53208.1| ribosomal protein S7 (chloroplast) [Oryza rufipogon] >gi|336327046|gb|AEI53222.1| ribosomal protein S7 (chloroplast) [Oryza rufipogon] >gi|346228348|gb|AEO21222.1| ribosomal protein S7 [Leersia tisserantii] >gi|346228361|gb|AEO21235.1| ribosomal protein S7 [Leersia tisserantii] >gi|346228516|gb|AEO21388.1| ribosomal protein S7 [Rhynchoryza subulata] >gi|346228529|gb|AEO21401.1| ribosomal protein S7 [Rhynchoryza subulata] >gi|353685098|gb|AER12863.1| ribosomal protein S7 (chloroplast) [Oryza sativa Indica Group] >gi|353685115|gb|AER12880.1| ribosomal protein S7 (chloroplast) [Oryza sativa Indica Group] >gi|353685185|gb|AER12949.1| ribosomal protein S7 (chloroplast) [Oryza sativa Indica Group] >gi|353685200|gb|AER12964.1| ribosomal protein S7 (chloroplast) [Oryza sativa Indica Group] >gi|552954527|gb|AGY48995.1| 30S ribosomal protein S7 (chloroplast) [Oryza rufipogon] >gi|552954559|gb|AGY49027.1| 30S ribosomal protein S7 (chloroplast) [Oryza rufipogon] >gi|555946032|gb|AGZ19258.1| ribosomal protein S7 (chloroplast) [Oryza rufipogon] >gi|555946053|gb|AGZ19279.1| ribosomal protein S7 (chloroplast) [Oryza rufipogon] >gi|634743503|gb|AHZ60754.1| ribosomal protein S7 [Oryza glaberrima] >gi|634743516|gb|AHZ60767.1| ribosomal protein S7 [Oryza glaberrima] >gi|662117333|gb|AIE44619.1| ribosomal protein S7 (chloroplast) [Oryza australiensis] >gi|662117346|gb|AIE44632.1| ribosomal protein S7 (chloroplast) [Oryza australiensis] >gi|226657|prf||1603356CH ribosomal protein S7)
BLAST of Medtr0002s0300.1 vs. NCBI nr
Match: gi|149275547|gb|ABR23110.1| (ribosomal protein S7 [Danthonia californica] >gi|441480378|gb|AGC38289.1| ribosomal protein S7 (chloroplast) [Cryptochloa strictiflora] >gi|441480390|gb|AGC38301.1| ribosomal protein S7 (chloroplast) [Cryptochloa strictiflora])
BLAST of Medtr0002s0300.1 vs. NCBI nr
Match: gi|195612924|gb|ACG28292.1| (40S ribosomal protein S5 [Zea mays])
BLAST of Medtr0002s0300.1 vs. NCBI nr
Match: gi|474303942|gb|EMS61696.1| (30S ribosomal protein S7, chloroplastic [Triticum urartu])
BLAST of Medtr0002s0300.1 vs. NCBI nr
Match: gi|19920144|gb|AAM08576.1|AC092750_10 (Putative ribosomal protein S7 from chromosome 10 chloroplast insetion [Oryza sativa Japonica Group])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0300.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|11467245|ref|NP_043077.1|2.066780e-8799.24ribosomal protein S7 [Zea mays] >gi|11467269|ref|N... [more]
gi|290790879|gb|ADD63135.1|4.568140e-8798.48ribosomal protein S7 [Microlaena stipoides] >gi|29... [more]
gi|552740|gb|AAA85360.1|6.022410e-8798.48ribosomal protein S7 (chloroplast) [Zea mays][more]
gi|42795519|gb|AAS46086.1|1.142980e-8698.48ribosomal protein S7 [Oryza sativa Indica Group] >... [more]
gi|357111582|ref|XP_003557591.1|1.210850e-8698.48PREDICTED: 30S ribosomal protein S7, chloroplastic... [more]
gi|11466836|ref|NP_039433.1|1.573370e-8698.48ribosomal protein S7 [Oryza sativa Japonica Group]... [more]
gi|149275547|gb|ABR23110.1|1.608090e-8698.48ribosomal protein S7 [Danthonia californica] >gi|4... [more]
gi|195612924|gb|ACG28292.1|2.061000e-8698.4840S ribosomal protein S5 [Zea mays][more]
gi|474303942|gb|EMS61696.1|2.898850e-8698.4830S ribosomal protein S7, chloroplastic [Triticum ... [more]
gi|19920144|gb|AAM08576.1|AC092750_107.490640e-8697.73Putative ribosomal protein S7 from chromosome 10 c... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000235Ribosomal protein S7GENE3D1.10.455.10no descriptioncoord: 2..132
score: 2.4
IPR000235Ribosomal protein S7SUPERFAMILY47973Ribosomal protein S7coord: 1..126
score: 6.6
IPR005717Ribosomal protein S7, bacterial-typeTIGRFAMsTIGR01029rpsG_bact: ribosomal protein S7coord: 1..132
score: 9.7

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0300.1 ID=Medtr0002s0300.1|Name=Medtr0002s0300.1|organism=Medicago truncatula|type=mRNA|length=399bp
ATGGTGGTTAACCGTATTATGAAATACGGAAAAAAATCATTGGCTTATCA
AATTCTCTATCGAGCCGTGAAAAAGATTCAACAAAAGACAGAAACAAATC
CACTATTGGTTTTACGTCAAGCAATACGTAGAGTAACTCCCAATATAGGA
GTAAAAACAAGACGTAATAAAAAAGGATCGACGCGGAAAGTTCCGATTGA
AATAGGATCTAAACAAGGAAGAGCACTTGCCATTCGTTGGTTATTAGAAG
CATCCCAAAAGCGTCCGGGTCGAAATATGGCTTTCAAATTAAGTTCCGAA
TTAGTAGATGCTGCCAAAGGGAGTGGGGGTGCCATACGCAAAAAGGAAGC
GACTCATAGAATGGCAGAGGCAAATAGAGCTCTTGCACATTTTCGTTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000235Ribosomal protein S7
IPR005717Ribosomal protein S7, bacterial-type
Vocabulary: Molecular Function
TermDefinition
GO:0003735structural constituent of ribosome
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005840ribosome
GO:0015935small ribosomal subunit
GO:0005575cellular_component
GO:0005739mitochondrion
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0006412translation
GO:0040007growth
GO:0008150biological_process