Overview
NameMedtr0002s0280.1
Unique NameMedtr0002s0280.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length480
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0040007 growth
biological_process GO:0006412 translation
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005739 mitochondrion
cellular_component GO:0043226 organelle
cellular_component GO:0005840 ribosome
cellular_component GO:0015935 small ribosomal subunit
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
molecular_function GO:0003735 structural constituent of ribosome
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00164.20188917-18917471-15629-114131.94.9e-43132.35.2e-39

Homology
BLAST of Medtr0002s0280.1 vs. NCBI nr
Match: gi|357140509|ref|XP_003571809.1| (PREDICTED: 30S ribosomal protein S12-B, chloroplastic-like [Brachypodium distachyon])
BLAST of Medtr0002s0280.1 vs. NCBI nr
Match: gi|357152079|ref|XP_003576003.1| (PREDICTED: 30S ribosomal protein S12-B, chloroplastic-like [Brachypodium distachyon])
BLAST of Medtr0002s0280.1 vs. NCBI nr
Match: gi|357115076|ref|XP_003559318.1| (PREDICTED: 30S ribosomal protein S12-B, chloroplastic-like [Brachypodium distachyon])
BLAST of Medtr0002s0280.1 vs. NCBI nr
Match: gi|297722889|ref|NP_001173808.1| (Os04g0234750 [Oryza sativa Japonica Group] >gi|255675244|dbj|BAH92536.1| Os04g0234750, partial [Oryza sativa Japonica Group])
BLAST of Medtr0002s0280.1 vs. NCBI nr
Match: gi|394831161|ref|YP_006503815.1| (ribosomal protein S12 (chloroplast) [Datura stramonium] >gi|350996572|gb|AEQ37083.1| ribosomal protein S12 [Datura stramonium])
BLAST of Medtr0002s0280.1 vs. NCBI nr
Match: gi|449474552|ref|XP_004154212.1| (PREDICTED: 30S ribosomal protein S12-B, chloroplastic-like [Cucumis sativus])
BLAST of Medtr0002s0280.1 vs. NCBI nr
Match: gi|364284008|ref|YP_004940490.1| (rps12 gene product (chloroplast) [Boea hygrometrica] >gi|340549431|gb|AEK53253.1| ribosomal protein S12 (chloroplast) [Boea hygrometrica])
BLAST of Medtr0002s0280.1 vs. NCBI nr
Match: gi|350996627|gb|AEQ37137.1| (ribosomal protein S12 (chloroplast) [Ginkgo biloba] >gi|350996664|gb|AEQ37174.1| ribosomal protein S12 (chloroplast) [Ginkgo biloba])
BLAST of Medtr0002s0280.1 vs. NCBI nr
Match: gi|158513641|sp|A4GYN8.1|RR12B_POPTR (RecName: Full=30S ribosomal protein S12-B, chloroplastic (chloroplast) [Populus trichocarpa] >gi|133712086|gb|ABO36729.1| 30S ribosomal protein S12 [Populus trichocarpa])
BLAST of Medtr0002s0280.1 vs. NCBI nr
Match: gi|359483109|ref|XP_003632904.1| (PREDICTED: 30S ribosomal protein S12-B, chloroplastic-like [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0280.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|357140509|ref|XP_003571809.1|3.652680e-5697.80PREDICTED: 30S ribosomal protein S12-B, chloroplas... [more]
gi|357152079|ref|XP_003576003.1|4.779050e-5697.80PREDICTED: 30S ribosomal protein S12-B, chloroplas... [more]
gi|357115076|ref|XP_003559318.1|6.307950e-5697.80PREDICTED: 30S ribosomal protein S12-B, chloroplas... [more]
gi|297722889|ref|NP_001173808.1|2.745520e-5494.57Os04g0234750 [Oryza sativa Japonica Group] >gi|255... [more]
gi|394831161|ref|YP_006503815.1|1.953950e-5294.44ribosomal protein S12 (chloroplast) [Datura stramo... [more]
gi|449474552|ref|XP_004154212.1|5.778250e-5293.26PREDICTED: 30S ribosomal protein S12-B, chloroplas... [more]
gi|364284008|ref|YP_004940490.1|1.102200e-5190.63rps12 gene product (chloroplast) [Boea hygrometric... [more]
gi|350996627|gb|AEQ37137.1|2.393500e-5193.26ribosomal protein S12 (chloroplast) [Ginkgo biloba... [more]
gi|158513641|sp|A4GYN8.1|RR12B_POPTR2.900680e-5094.25RecName: Full=30S ribosomal protein S12-B, chlorop... [more]
gi|359483109|ref|XP_003632904.1|9.198950e-5087.10PREDICTED: 30S ribosomal protein S12-B, chloroplas... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR005679Ribosomal protein S12, bacteriaPRINTSPR01034RIBOSOMALS12coord: 83..98
score: 2.9e-43coord: 99..118
score: 2.9e-43coord: 118..135
score: 2.9e-43coord: 135..151
score: 2.9e-43coord: 151..159
score: 2.9
IPR005679Ribosomal protein S12, bacteriaTIGRFAMsTIGR00981rpsL_bact: ribosomal protein S12coord: 47..158
score: 1.2
IPR006032Ribosomal protein S12/S23PROSITEPS00055RIBOSOMAL_S12coord: 84..91
score
IPR012340Nucleic acid-binding, OB-foldGENE3D2.40.50.140no descriptioncoord: 73..156
score: 6
IPR016027Nucleic acid-binding, OB-fold-likeSUPERFAMILY50249Nucleic acid-binding proteinscoord: 43..157
score: 4.6

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0280.1 ID=Medtr0002s0280.1|Name=Medtr0002s0280.1|organism=Medicago truncatula|type=mRNA|length=480bp
ATGAGATTCATAGTTGCATTACTTATAGCTTCCTTATTCGTAGACAAAGC
AGATTCGGAATTGTCTTTCCTTCCAAGGATAACTTGTATCCATGCGCTTC
AGATTATTAGCCTGGAGTTCGCCACCAGCAGTATAGCCAACCCTACCCTA
TCACGTCAATCCCACAAGCCTCTTATCCATTCTCGTTCGCTCGTGGCGGG
GGAGGACAGTAAGGGTGACTTATCTGTCGACTTTTCCACTATCAACCCCA
AAAAACCCAACTCTGCCTTACGTAAAGTTGCCAGAGTACGATTAACCTCT
GGATTTGAAATCACTGCTTATATACCTGGTATTGGCCATAATTTACAAGA
ACATTCTGTAGTATTAGTAAGAGGAGGAAGGGTTAAGGATTTACCCGGTG
TGAGATATCGCATTATTCGAGGAACCCTAGATGCTGTCGGAGTAAAGGAT
CGTCAACAAGGGCGTTCTAGTGCGTTGTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR005679Ribosomal protein S12, bacteria
IPR006032Ribosomal protein S12/S23
IPR012340Nucleic acid-binding, OB-fold
IPR016027Nucleic acid-binding, OB-fold-like
Vocabulary: Molecular Function
TermDefinition
GO:0003735structural constituent of ribosome
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Biological Process
TermDefinition
GO:0006412translation
GO:0040007growth
GO:0008150biological_process
Vocabulary: Cellular Component
TermDefinition
GO:0015935small ribosomal subunit
GO:0005622intracellular
GO:0005840ribosome
GO:0005575cellular_component
GO:0005739mitochondrion
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part