Overview
NameMedtr0002s0260.1
Unique NameMedtr0002s0260.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length225
Homology
BLAST of Medtr0002s0260.1 vs. NCBI nr
Match: gi|487827639|ref|WP_001901105.1| (hypothetical protein [Vibrio cholerae] >gi|126518156|gb|EAZ75381.1| hypothetical protein A5E_B0095 [Vibrio cholerae B33])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0260.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 1
Match NameE-valueIdentityDescription
gi|487827639|ref|WP_001901105.1|1.233090e-1995.24hypothetical protein [Vibrio cholerae] >gi|1265181... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0260.1 ID=Medtr0002s0260.1|Name=Medtr0002s0260.1|organism=Medicago truncatula|type=mRNA|length=225bp
ATGGGATCTCACCTGAATCGCCCCATCTATCCTCCTGAGGAGAAGTTTGT
TTGGTTTCAAACTCCGATTCAAACAGGAGGAGTACGCCATGCTAATGTGC
CTTGGATGATCCACATCTTCGGGTCAGGCGCTGATGAGCACATTGAACTA
TCCATGTGGCTGAGAGCCCTCACAGCCCAGGCACAACGACGCAATTATCA
GGGGCGCGCTCTACCACTGAGCTAA
back to top