Overview
NameMedtr0002s0210.1
Unique NameMedtr0002s0210.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length471
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0009058 biosynthetic process
biological_process GO:0044249 cellular biosynthetic process
biological_process GO:0016043 cellular component organization
biological_process GO:0071840 cellular component organization or biogenesis
biological_process GO:0034645 cellular macromolecule biosynthetic process
biological_process GO:0044260 cellular macromolecule metabolic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0044267 cellular protein metabolic process
biological_process GO:0010467 gene expression
biological_process GO:0009059 macromolecule biosynthetic process
biological_process GO:0043170 macromolecule metabolic process
biological_process GO:0008152 metabolic process
biological_process GO:0032543 mitochondrial translation
biological_process GO:0007005 mitochondrion organization
biological_process GO:0006996 organelle organization
biological_process GO:1901576 organic substance biosynthetic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0044238 primary metabolic process
biological_process GO:0019538 protein metabolic process
biological_process GO:0044711 single-organism biosynthetic process
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044710 single-organism metabolic process
biological_process GO:0044699 single-organism process
biological_process GO:0006412 translation
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0071944 cell periphery
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0016020 membrane
cellular_component GO:0005886 plasma membrane
cellular_component GO:0005840 ribosome
molecular_function GO:0003723 RNA binding
molecular_function GO:0005488 binding
molecular_function GO:1901363 heterocyclic compound binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0003676 nucleic acid binding
molecular_function GO:0097159 organic cyclic compound binding
molecular_function GO:0019843 rRNA binding
molecular_function GO:0003735 structural constituent of ribosome
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00312.17179386-1791448-883-83107.91.1e-35108.49.7e-32

Homology
BLAST of Medtr0002s0210.1 vs. NCBI nr
Match: gi|118430433|ref|YP_874698.1| (ribosomal protein S15 [Hordeum vulgare subsp. vulgare] >gi|118430444|ref|YP_874709.1| ribosomal protein S15 [Hordeum vulgare subsp. vulgare] >gi|215275008|sp|A1E9N6.1|RR15_HORVU RecName: Full=30S ribosomal protein S15, chloroplastic (chloroplast) [Hordeum vulgare] >gi|118201087|gb|ABK79458.1| ribosomal protein S15 [Hordeum vulgare subsp. vulgare] >gi|118201098|gb|ABK79469.1| ribosomal protein S15 [Hordeum vulgare subsp. vulgare] >gi|521300997|gb|AGP50800.1| ribosomal protein S15 (chloroplast) [Hordeum vulgare subsp. vulgare] >gi|521301077|gb|AGP50879.1| ribosomal protein S15 (chloroplast) [Hordeum vulgare subsp. spontaneum] >gi|521301157|gb|AGP50958.1| ribosomal protein S15 (chloroplast) [Hordeum vulgare subsp. spontaneum])
BLAST of Medtr0002s0210.1 vs. NCBI nr
Match: gi|14017618|ref|NP_114303.1| (ribosomal protein S15 [Triticum aestivum] >gi|14017630|ref|NP_114315.1| ribosomal protein S15 [Triticum aestivum] >gi|525778553|ref|YP_008239140.1| ribosomal protein S15 (chloroplast) (chloroplast) [Triticum monococcum] >gi|525782261|ref|YP_008239217.1| ribosomal protein S15 (chloroplast) (chloroplast) [Secale cereale] >gi|525782324|ref|YP_008239277.1| ribosomal protein S15 (chloroplast) (chloroplast) [Triticum urartu] >gi|533310154|ref|YP_008474348.1| ribosomal protein S15 (chloroplast) [Aegilops tauschii] >gi|533310248|ref|YP_008474438.1| ribosomal protein S15 (chloroplast) [Aegilops speltoides] >gi|568245044|ref|YP_008963952.1| ribosomal protein S15 (chloroplast) (chloroplast) [Aegilops geniculata] >gi|62288971|sp|P69661.1|RR15_WHEAT RecName: Full=30S ribosomal protein S15, chloroplastic (chloroplast) [Triticum aestivum] >gi|62288972|sp|P69662.1|RR15_SECCE RecName: Full=30S ribosomal protein S15, chloroplastic >gi|12236|emb|CAA32916.1| unnamed protein product [Secale cereale] >gi|13928251|dbj|BAB47080.1| ribosomal protein S 15 [Triticum aestivum] >gi|13928263|dbj|BAB47092.1| ribosomal protein S15 [Triticum aestivum] >gi|384406901|gb|AFH89558.1| ribosomal protein S15 (chloroplast) [Aegilops tauschii] >gi|394986539|gb|AFN42420.1| ribosomal protein S15 (chloroplast) [Aegilops speltoides] >gi|521301238|gb|AGP51038.1| ribosomal protein S15 (chloroplast) [Triticum monococcum] >gi|521301315|gb|AGP51114.1| ribosomal protein S15 (chloroplast) [Secale cereale] >gi|521301394|gb|AGP51192.1| ribosomal protein S15 (chloroplast) [Triticum monococcum subsp. aegilopoides] >gi|521301455|gb|AGP51252.1| ribosomal protein S15 (chloroplast) [Triticum urartu] >gi|521301535|gb|AGP51331.1| ribosomal protein S15 (chloroplast) [Triticum aestivum] >gi|554515680|gb|AGY92982.1| ribosomal protein S15 (chloroplast) [Aegilops geniculata])
BLAST of Medtr0002s0210.1 vs. NCBI nr
Match: gi|511347619|ref|YP_008080541.1| (ribosomal protein S15 (chloroplast) [Pharus latifolius] >gi|511347630|ref|YP_008080552.1| ribosomal protein S15 (chloroplast) [Pharus latifolius] >gi|336280840|gb|AEI29128.1| ribosomal protein S15 (chloroplast) [Pharus latifolius] >gi|336280851|gb|AEI29139.1| ribosomal protein S15 (chloroplast) [Pharus latifolius])
BLAST of Medtr0002s0210.1 vs. NCBI nr
Match: gi|159106909|ref|YP_001531327.1| (rps15 gene product (chloroplast) [Lolium perenne] >gi|159106921|ref|YP_001531339.1| rps15 gene product (chloroplast) [Lolium perenne] >gi|218176287|ref|YP_002364544.1| ribosomal protein S15 [Festuca arundinacea] >gi|218176298|ref|YP_002364555.1| ribosomal protein S15 [Festuca arundinacea] >gi|426406684|ref|YP_007026599.1| ribosomal protein S15 [Festuca ovina] >gi|426406696|ref|YP_007026611.1| ribosomal protein S15 [Festuca ovina] >gi|427437117|ref|YP_007026685.1| ribosomal protein S15 [Festuca pratensis] >gi|427437129|ref|YP_007026697.1| ribosomal protein S15 [Festuca pratensis] >gi|427437263|ref|YP_007026771.1| ribosomal protein S15 [Lolium multiflorum] >gi|427437275|ref|YP_007026783.1| ribosomal protein S15 [Lolium multiflorum] >gi|589229868|ref|YP_009003875.1| ribosomal protein S15 [Deschampsia antarctica] >gi|589229880|ref|YP_009003887.1| ribosomal protein S15 [Deschampsia antarctica] >gi|215275014|sp|A8Y9D2.1|RR15_LOLPR RecName: Full=30S ribosomal protein S15, chloroplastic (chloroplast) [Lolium perenne] >gi|158934443|emb|CAO86021.1| ribosomal protein S15 (chloroplast) [Lolium perenne] >gi|158934455|emb|CAO86033.1| ribosomal protein S15 (chloroplast) [Lolium perenne] >gi|215882371|gb|ACJ70801.1| ribosomal protein S15 [Festuca arundinacea] >gi|215882382|gb|ACJ70812.1| ribosomal protein S15 [Festuca arundinacea] >gi|410177898|gb|AFV62778.1| ribosomal protein S15 [Festuca ovina] >gi|410177910|gb|AFV62790.1| ribosomal protein S15 [Festuca ovina] >gi|410177985|gb|AFV62864.1| ribosomal protein S15 [Festuca pratensis] >gi|410177997|gb|AFV62876.1| ribosomal protein S15 [Festuca pratensis] >gi|410178072|gb|AFV62950.1| ribosomal protein S15 [Lolium multiflorum] >gi|410178084|gb|AFV62962.1| ribosomal protein S15 [Lolium multiflorum] >gi|582041380|gb|AHI43090.1| ribosomal protein S15 [Deschampsia antarctica] >gi|582041392|gb|AHI43102.1| ribosomal protein S15 [Deschampsia antarctica])
BLAST of Medtr0002s0210.1 vs. NCBI nr
Match: gi|339906497|ref|YP_004733289.1| (ribosomal protein S15 [Indocalamus longiauritus] >gi|339906508|ref|YP_004733300.1| ribosomal protein S15 [Indocalamus longiauritus] >gi|340034071|ref|YP_004733624.1| ribosomal protein S15 [Phyllostachys edulis] >gi|340034081|ref|YP_004733635.1| ribosomal protein S15 [Phyllostachys edulis] >gi|340034242|ref|YP_004733805.1| ribosomal protein S15 [Acidosasa purpurea] >gi|340034253|ref|YP_004733816.1| ribosomal protein S15 [Acidosasa purpurea] >gi|340034410|ref|YP_004734024.1| ribosomal protein S15 [Phyllostachys nigra var. henonis] >gi|340034421|ref|YP_004734035.1| ribosomal protein S15 [Phyllostachys nigra var. henonis] >gi|340034582|ref|YP_004734231.1| ribosomal protein S15 [Ferrocalamus rimosivaginus] >gi|340034593|ref|YP_004734242.1| ribosomal protein S15 [Ferrocalamus rimosivaginus] >gi|374249396|ref|YP_005088578.1| rps15 gene product (chloroplast) [Phyllostachys propinqua] >gi|374249407|ref|YP_005088589.1| rps15 gene product (chloroplast) [Phyllostachys propinqua] >gi|452849527|ref|YP_007475185.1| ribosomal protein S15 (chloroplast) [Arundinaria gigantea] >gi|452849538|ref|YP_007475196.1| ribosomal protein S15 (chloroplast) [Arundinaria gigantea] >gi|608787603|ref|YP_009024300.1| ribosomal protein S15 (chloroplast) [Arundinaria appalachiana] >gi|608787614|ref|YP_009024311.1| ribosomal protein S15 (chloroplast) [Arundinaria appalachiana] >gi|608787687|ref|YP_009024383.1| ribosomal protein S15 (chloroplast) [Arundinaria tecta] >gi|608787697|ref|YP_009024393.1| ribosomal protein S15 (chloroplast) [Arundinaria tecta] >gi|307133931|gb|ADN32936.1| ribosomal protein S15 [Phyllostachys nigra var. henonis] >gi|307133942|gb|ADN32947.1| ribosomal protein S15 [Phyllostachys nigra var. henonis] >gi|309321662|gb|ADO65187.1| ribosomal protein S15 [Acidosasa purpurea] >gi|309321673|gb|ADO65198.1| ribosomal protein S15 [Acidosasa purpurea] >gi|309321747|gb|ADO65271.1| ribosomal protein S15 [Ferrocalamus rimosivaginus] >gi|309321758|gb|ADO65282.1| ribosomal protein S15 [Ferrocalamus rimosivaginus] >gi|309321830|gb|ADO65353.1| ribosomal protein S15 [Indocalamus longiauritus] >gi|309321841|gb|ADO65364.1| ribosomal protein S15 [Indocalamus longiauritus] >gi|309321913|gb|ADO65435.1| ribosomal protein S15 [Phyllostachys edulis] >gi|309321923|gb|ADO65445.1| ribosomal protein S15 [Phyllostachys edulis] >gi|346228433|gb|AEO21306.1| ribosomal protein S15 (chloroplast) [Phyllostachys propinqua] >gi|346228444|gb|AEO21317.1| ribosomal protein S15 (chloroplast) [Phyllostachys propinqua] >gi|441480295|gb|AGC38207.1| ribosomal protein S15 (chloroplast) [Arundinaria gigantea] >gi|441480306|gb|AGC38218.1| ribosomal protein S15 (chloroplast) [Arundinaria gigantea] >gi|511262271|gb|AGN72265.1| ribosomal protein S15 (chloroplast) [Arundinaria appalachiana] >gi|511262282|gb|AGN72276.1| ribosomal protein S15 (chloroplast) [Arundinaria appalachiana] >gi|511262355|gb|AGN72348.1| ribosomal protein S15 (chloroplast) [Arundinaria tecta] >gi|511262365|gb|AGN72358.1| ribosomal protein S15 (chloroplast) [Arundinaria tecta])
BLAST of Medtr0002s0210.1 vs. NCBI nr
Match: gi|118430348|ref|YP_874782.1| (ribosomal protein S15 [Agrostis stolonifera] >gi|118430360|ref|YP_874794.1| ribosomal protein S15 [Agrostis stolonifera] >gi|125987685|sp|A1EA54.1|RR15_AGRST RecName: Full=30S ribosomal protein S15, chloroplastic (chloroplast) [Agrostis stolonifera] >gi|118201257|gb|ABK79626.1| ribosomal protein S15 [Agrostis stolonifera] >gi|118201269|gb|ABK79638.1| ribosomal protein S15 [Agrostis stolonifera])
BLAST of Medtr0002s0210.1 vs. NCBI nr
Match: gi|586929279|ref|YP_009002040.1| (ribosomal protein S15 (chloroplast) [Puelia olyriformis] >gi|586929290|ref|YP_009002051.1| ribosomal protein S15 (chloroplast) [Puelia olyriformis] >gi|337730942|gb|AEI70815.1| ribosomal protein S15 [Puelia olyriformis] >gi|469474050|gb|AGH33820.1| ribosomal protein S15 (chloroplast) [Puelia olyriformis] >gi|469474061|gb|AGH33831.1| ribosomal protein S15 (chloroplast) [Puelia olyriformis])
BLAST of Medtr0002s0210.1 vs. NCBI nr
Match: gi|255961426|ref|YP_003097621.1| (ribosomal protein S15 [Dendrocalamus latiflorus] >gi|255961438|ref|YP_003097633.1| ribosomal protein S15 [Dendrocalamus latiflorus] >gi|340034496|ref|YP_004734147.1| ribosomal protein S15 [Bambusa emeiensis] >gi|340034514|ref|YP_004734158.1| ribosomal protein S15 [Bambusa emeiensis] >gi|642276500|ref|YP_009033497.1| ribosomal protein S15 [Olyra latifolia] >gi|133797|sp|P17703.1|RR15_MAIZE RecName: Full=30S ribosomal protein S15, chloroplastic (chloroplast) [Zea mays] >gi|255040315|gb|ACT99975.1| ribosomal protein S15 [Dendrocalamus latiflorus] >gi|255099164|gb|ACT99963.1| ribosomal protein S15 [Dendrocalamus latiflorus] >gi|309321999|gb|ADO65520.1| ribosomal protein S15 [Bambusa emeiensis] >gi|309322017|gb|ADO65538.1| ribosomal protein S15 [Bambusa emeiensis] >gi|555298196|gb|AGZ13296.1| ribosomal protein S15 [Olyra latifolia])
BLAST of Medtr0002s0210.1 vs. NCBI nr
Match: gi|295065775|ref|YP_003587715.1| (ribosomal protein S15 [Anomochloa marantoidea] >gi|295065786|ref|YP_003587726.1| ribosomal protein S15 [Anomochloa marantoidea] >gi|251765299|gb|ACT15453.1| ribosomal protein S15 [Anomochloa marantoidea] >gi|251765310|gb|ACT15464.1| ribosomal protein S15 [Anomochloa marantoidea])
BLAST of Medtr0002s0210.1 vs. NCBI nr
Match: gi|290790880|gb|ADD63136.1| (ribosomal protein S15 [Microlaena stipoides] >gi|290790892|gb|ADD63148.1| ribosomal protein S15 [Microlaena stipoides])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0210.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|118430433|ref|YP_874698.1|1.519370e-5398.89ribosomal protein S15 [Hordeum vulgare subsp. vulg... [more]
gi|14017618|ref|NP_114303.1|7.665680e-5397.78ribosomal protein S15 [Triticum aestivum] >gi|1401... [more]
gi|511347619|ref|YP_008080541.1|1.227230e-5193.48ribosomal protein S15 (chloroplast) [Pharus latifo... [more]
gi|159106909|ref|YP_001531327.1|2.014010e-5196.67rps15 gene product (chloroplast) [Lolium perenne] ... [more]
gi|339906497|ref|YP_004733289.1|2.396080e-5196.63ribosomal protein S15 [Indocalamus longiauritus] >... [more]
gi|118430348|ref|YP_874782.1|4.958920e-5195.56ribosomal protein S15 [Agrostis stolonifera] >gi|1... [more]
gi|586929279|ref|YP_009002040.1|7.095160e-5194.44ribosomal protein S15 (chloroplast) [Puelia olyrif... [more]
gi|255961426|ref|YP_003097621.1|9.408730e-5195.51ribosomal protein S15 [Dendrocalamus latiflorus] >... [more]
gi|295065775|ref|YP_003587715.1|1.501290e-5092.39ribosomal protein S15 [Anomochloa marantoidea] >gi... [more]
gi|290790880|gb|ADD63136.1|4.589010e-5093.33ribosomal protein S15 [Microlaena stipoides] >gi|2... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000589Ribosomal protein S15PROSITEPS00362RIBOSOMAL_S15coord: 39..69
score
IPR005290Ribosomal protein S15, bacterial-typeTIGRFAMsTIGR00952S15_bact: ribosomal protein S15coord: 14..89
score: 3.4
IPR009068S15/NS1, RNA-bindingGENE3D1.10.287.10no descriptioncoord: 16..88
score: 5.2
IPR009068S15/NS1, RNA-bindingSUPERFAMILY47060S15/NS1 RNA-binding domaincoord: 12..89
score: 1.7
NoneNo IPR availablePRODOMPD157043RR15_MAIZE_P17703;coord: 19..88
score: 1
NoneNo IPR availableSEGsegsegcoord: 54..73
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0210.1 ID=Medtr0002s0210.1|Name=Medtr0002s0210.1|organism=Medicago truncatula|type=mRNA|length=471bp
ATGAAAAAGAAAGGAGGTAGAAAAATTTTAGGATTTATGGTTAAAGAAGA
AAAAGAAGAAAACAGGGGTTCTGTTGAATTTCAAGTATTCAGTTTCACCA
ATAAGATACGGAGACTTGCTTCACATTTGGAATTACACAAAAAAGATTTT
TCATCGGAAAGAGGTCTACGAAGACTTTTGGGAAAACGTCGACGTTTGCT
GGCTTATTTGGCAAAGAAAAATAGAGTACGTTATAAGAAATTAATCGGTC
AGTTGAATATTCGGGAGCATAGTCTTTATAGTAGTCTTAGATTTTTCATT
TTGATGAGCCTCACTTTGAGGAATTCATGGAATAATCCATTTTCATGGAA
TAATGAATTAAGGAAGAAAGGATATGAGTCTACCGCTTACAAAAAAAGAT
CTCATGATAGTCAATATGGGCCCTCAACACCCATCAATGCATGGTGTTCT
TCGACTGATCGTTACTCTTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000589Ribosomal protein S15
IPR005290Ribosomal protein S15, bacterial-type
IPR009068S15/NS1, RNA-binding
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0003735structural constituent of ribosome
GO:0003674molecular_function
GO:0003676nucleic acid binding
GO:0003723RNA binding
GO:0005488binding
GO:0019843rRNA binding
GO:0097159organic cyclic compound binding
GO:1901363heterocyclic compound binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005840ribosome
GO:0005886plasma membrane
GO:0005575cellular_component
GO:0016020membrane
GO:0005623cell
GO:0044464cell part
GO:0071944cell periphery
Vocabulary: Biological Process
TermDefinition
GO:0006412translation
GO:0008152metabolic process
GO:0006996organelle organization
GO:0007005mitochondrion organization
GO:0008150biological_process
GO:0009058biosynthetic process
GO:0009059macromolecule biosynthetic process
GO:0009987cellular process
GO:0010467gene expression
GO:0016043cellular component organization
GO:0019538protein metabolic process
GO:0032543mitochondrial translation
GO:0034645cellular macromolecule biosynthetic process
GO:0043170macromolecule metabolic process
GO:0044237cellular metabolic process
GO:0044238primary metabolic process
GO:0044249cellular biosynthetic process
GO:0044260cellular macromolecule metabolic process
GO:0044267cellular protein metabolic process
GO:0044699single-organism process
GO:0044710single-organism metabolic process
GO:0044711single-organism biosynthetic process
GO:0044763single-organism cellular process
GO:0071704organic substance metabolic process
GO:0071840cellular component organization or biogenesis
GO:1901576organic substance biosynthetic process