Overview
NameMedtr0002s0120.1
Unique NameMedtr0002s0120.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length2487
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0006952 defense response
biological_process GO:0050896 response to stimulus
biological_process GO:0006950 response to stress
cellular_component GO:0005575 cellular_component
cellular_component GO:0016020 membrane
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00560.28153832-153764408-4301-2212.62.8e-0529.52.8e-07
PF00931.17154762-15433498-240140-285119.33.7e-38120.65e-35
PF12799.2153832-153716408-4462-3928.32.5e-1059.31.7e-16
PF13855.1153832-153677408-4592-5428.03.6e-1048.93.5e-13

Homology
BLAST of Medtr0002s0120.1 vs. NCBI nr
Match: gi|502127140|ref|XP_004499578.1| (PREDICTED: putative disease resistance protein At3g14460-like [Cicer arietinum] >gi|532127448|gb|AGT75404.1| CC-NBS-LRR disease resistance protein [Cicer arietinum])
BLAST of Medtr0002s0120.1 vs. NCBI nr
Match: gi|502127636|ref|XP_004499781.1| (PREDICTED: putative disease resistance protein At3g14460-like [Cicer arietinum])
BLAST of Medtr0002s0120.1 vs. NCBI nr
Match: gi|502175746|ref|XP_004515733.1| (PREDICTED: putative disease resistance protein At3g14460-like isoform X1 [Cicer arietinum] >gi|502175750|ref|XP_004515734.1| PREDICTED: putative disease resistance protein At3g14460-like isoform X2 [Cicer arietinum] >gi|502175755|ref|XP_004515735.1| PREDICTED: putative disease resistance protein At3g14460-like isoform X3 [Cicer arietinum])
BLAST of Medtr0002s0120.1 vs. NCBI nr
Match: gi|502179928|ref|XP_004516528.1| (PREDICTED: putative disease resistance protein At3g14460-like [Cicer arietinum])
BLAST of Medtr0002s0120.1 vs. NCBI nr
Match: gi|502163726|ref|XP_004512929.1| (PREDICTED: putative disease resistance protein At3g14460-like isoform X1 [Cicer arietinum] >gi|564113523|gb|AHB64356.1| NBS-LRR protein [Cicer arietinum])
BLAST of Medtr0002s0120.1 vs. NCBI nr
Match: gi|356550917|ref|XP_003543829.1| (PREDICTED: putative disease resistance protein At3g14460-like [Glycine max])
BLAST of Medtr0002s0120.1 vs. NCBI nr
Match: gi|356577373|ref|XP_003556801.1| (PREDICTED: putative disease resistance RPP13-like protein 1-like [Glycine max])
BLAST of Medtr0002s0120.1 vs. NCBI nr
Match: gi|356577375|ref|XP_003556802.1| (PREDICTED: putative disease resistance RPP13-like protein 1-like isoform X1 [Glycine max] >gi|571564363|ref|XP_006605611.1| PREDICTED: putative disease resistance RPP13-like protein 1-like isoform X2 [Glycine max])
BLAST of Medtr0002s0120.1 vs. NCBI nr
Match: gi|356577440|ref|XP_003556833.1| (PREDICTED: putative disease resistance protein At3g14460-like isoform X1 [Glycine max] >gi|571564649|ref|XP_006605649.1| PREDICTED: putative disease resistance protein At3g14460-like isoform X2 [Glycine max])
BLAST of Medtr0002s0120.1 vs. NCBI nr
Match: gi|502124790|ref|XP_004498673.1| (PREDICTED: putative disease resistance RPP13-like protein 1-like isoform X1 [Cicer arietinum] >gi|502124792|ref|XP_004498674.1| PREDICTED: putative disease resistance RPP13-like protein 1-like isoform X2 [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0120.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502127140|ref|XP_004499578.1|0.000000e+072.49PREDICTED: putative disease resistance protein At3... [more]
gi|502127636|ref|XP_004499781.1|0.000000e+073.32PREDICTED: putative disease resistance protein At3... [more]
gi|502175746|ref|XP_004515733.1|0.000000e+075.14PREDICTED: putative disease resistance protein At3... [more]
gi|502179928|ref|XP_004516528.1|0.000000e+072.35PREDICTED: putative disease resistance protein At3... [more]
gi|502163726|ref|XP_004512929.1|0.000000e+067.84PREDICTED: putative disease resistance protein At3... [more]
gi|356550917|ref|XP_003543829.1|0.000000e+052.94PREDICTED: putative disease resistance protein At3... [more]
gi|356577373|ref|XP_003556801.1|0.000000e+050.92PREDICTED: putative disease resistance RPP13-like ... [more]
gi|356577375|ref|XP_003556802.1|0.000000e+051.00PREDICTED: putative disease resistance RPP13-like ... [more]
gi|356577440|ref|XP_003556833.1|0.000000e+052.46PREDICTED: putative disease resistance protein At3... [more]
gi|502124790|ref|XP_004498673.1|0.000000e+046.95PREDICTED: putative disease resistance RPP13-like ... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000767Disease resistance proteinPRINTSPR00364DISEASERSISTcoord: 152..166
score: 4e-05coord: 404..420
score: 4
NoneNo IPR availableGENE3D3.80.10.10no descriptioncoord: 346..546
score: 1.4e-18coord: 563..755
score: 3.3
NoneNo IPR availableSEGsegsegcoord: 403..417
score: NAcoord: 684..692
score
NoneNo IPR availableSUPERFAMILY52058L domain-likecoord: 275..732
score: 2.4e-45coord: 711..827
score: 2.2
NoneNo IPR availableSUPERFAMILY52540P-loop containing nucleoside triphosphate hydrolasescoord: 108..190
score: 8.7

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0120.1 ID=Medtr0002s0120.1|Name=Medtr0002s0120.1|organism=Medicago truncatula|type=mRNA|length=2487bp
ATGGAACATCCCAGACTGCTTTCAGCATTGTCGACTGACCCCACAAACCA
ACACGAGTCTTTTCAGCGTGTTTTGTCCTCACTAGCACACTTACCGAGAA
ACTTCCCGTCCCATACCTACAAGGCCTCAGGAGCCCTCTCATTCCGGCGT
GATTCGGTTCCTCTAGAAGCTGTCGAGAGCCGCTCATTGTCGTGCCTTGT
GCACCGGCGACACTCCCCGCCCTCATCAGCCTTGGGTGTTACATGCCCAC
CAGCTTCCGCTTGGTTCGTCCCCGAACGACACCGTACTGGGAGAGTTGCG
GAGGTTGCACACACGTTTCCTATTCACAAAGTAGATCCTCTATCAGATGA
TGACTGTTGGTCGTTACTTTCAAAGCATGCATTCGGAAGTGAAGACCGTC
GAGGTAGAAAGTACCCAAATCTAGAAGAAATTGGTAGAAAGATTGCCAAA
AAGTGTGGTGGATTGCCCATAGCTGCTAAAACACTCGGAGGAATTTTGCG
TTCAAAGGTAGATGCAAAAGAGTGGACTGCAATTCTAAATAGTGACATAT
GGAACTTACCAAATGATACAATTTTACCTGCTTTGCGTCTAAGTTATCAA
TATCTTCCCTCACATTTGAAAAGATGTTTTGCCTATTGCTCAATTTTTCC
GAAGGATTTTCCACTTGACAAGAAGGAATTGATTTTGTTATGGATGGCAG
AAGGCTTCCTAGAGCGTTCTCAACGTAATAAAACAGCTGAGGAAGTAGGC
CATGACTACTTTATTGAATTGTTATCCAGGTCCTTAATTCAACAATCAAA
TGATGATGGAAAAGAAAAATTTGTTATGCACGACCTTGTCAATGATTTAG
CCTTAGTGGTGTCAGGAACAAGTTGCTTCAGGCTTGAATTTGGTGGTAAC
ATGTCTAAAAATGTTCGTCATTTTTCATATAATCAAGGAGATTACGACTT
TTTCAAGAAGTTTGAGGTTCTCTACGATTTCAAGTGCTTGCGAAGCTTTC
TACCCATTAACCTACGCAACTGGGTAGGAGGATATTACTTATCTAGTAAG
GTTGTTGAAGATTTAATACCCAAACTCAAACGGTTACGCGTGCTATCCTT
AAAATATTATCGAAACATCAACATACTGCCAGAATCAGTTGGTAGTTTGG
TGGAGTTGAGGTATTTAGATCTCTCATTCACTGGAATTAAAAGCTTACCT
AATGCAACATGCAATCTTTACAATCTGCAAACCTTGAATTTAACACAATG
TGAAAACCTCACTGAGTTGCCACTACATTTTGGAAAGTTAATTAACTTAC
GGCACCTTGATATTAGTAAGACAAATATAAAGGAGATGCCAATGCAAATT
GTTGGACTCAATAACCTGCAAACATTAACTGATTTTTCAGTCGGCAAGCA
AGACACCGGGTTAAGTGTCAAAGAGGTTGGTAAGTTTCCTAACCTGCGGG
GAAAACTTTGTATCAAGAACCTGCAGAATGTCAGCGATGCCATTGAGGCG
TATGATGTCAACATGAGAAAAAAAGAACATATTGAGGAGTTAGAGTTACA
ATGGAGCAAACAAACGGAAGATTCGCGAACAGAGAAGGATGTGCTTGATA
TTTTACAACCTTCATTTAACCTTAGGAAGCTGATTATTAGGTTGTATGGT
GGAACAAGCTTCCCGAGTTGGTTGGGTGATCCTTTGTTTTCTAACATGGT
GTCCTTGTGTATCTCGAATTGTGAATATTGTGTAACACTTCCACCACTAG
GCCAACTACCTTCTCTCAAGGACTTGACTATTGAGGGTATGACAATGGAA
ACAATTGGGCTAGAGTTCTATGGGATGACAGTAGAACCTTCCATTTCATT
ATTCCGACCATTTCAATCTCTCGAGTCTTTACAAATCTCAAGTATGCCGA
ATTGGAAAGAATGGATACACTATGAAAATGATGAGTTTAATTTTCCTCGC
CTTAGAACTTTGTGCTTAAGCCAATGTCCTAAACTAAAGGGACATTTGCC
TAGCAGTCTTCCTTCAATAGATGAAATCAATATAACTGGTTGTGACCGTC
TCTTGACAACACCACCAACTACTTTGCATTGGCTCTCCTCATTAAACAAA
ATAGGTATAAATTGGTCTACAGGAAGTTCCCAATGGTTGTTACTTGAGAT
TGATTCTCCTTGTGTGCTTCAAGGTGCAACAATCTATTATTGTGATACCC
TGTTTTCTTTACCCAAAATTATTAGGAGCAGCATTTGTCTTCGATTCTTG
ATACTTTATGATGTTCCATCTCTCGCTGCTTTTCCAACAGATGGTCTACC
CACTTCATTGCAGTCACTTAGAATTGATGATTGTCCGAATTTAGCATTCC
TGCCACTTGAAACATGGGGCAATTACACATCTCTTGTGACTTTGCACTTA
TGGAATAGTTGTTATGCACTTACCTCATTCCCTTTGGATGGTTTCCCAGC
CCTCCAAGATCTTTCNGATCTTGTATTTGAATTTTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000767Disease resistance protein
noIPRunintegrated
Vocabulary: Biological Process
TermDefinition
GO:0006952defense response
GO:0006950response to stress
GO:0008150biological_process
GO:0050896response to stimulus
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005575cellular_component
GO:0016020membrane