Overview
NameMedtr0002s0100.1
Unique NameMedtr0002s0100.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length696
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0015977 carbon fixation
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
cellular_component GO:0009536 plastid
molecular_function GO:0005488 binding
molecular_function GO:0000287 magnesium ion binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
molecular_function GO:0016984 ribulose-bisphosphate carboxylase activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00016.15137689-13802439-1501-112198.02e-62198.59.9e-59
PF02788.11137575-1376671-3196-12641.11.6e-1442.15.5e-11

Homology
BLAST of Medtr0002s0100.1 vs. NCBI nr
Match: gi|407741987|gb|AFU34272.1| (ribulose-1,5-bisphosphate carboxylase/oxygenas large subunit, partial (chloroplast) [Galphimia glauca])
BLAST of Medtr0002s0100.1 vs. NCBI nr
Match: gi|308054921|gb|ADO01507.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Panax quinquefolius])
BLAST of Medtr0002s0100.1 vs. NCBI nr
Match: gi|371928331|gb|AEX58897.1| (ribulose 1,5-bisphosphate carboxylase [Viburnum veitchii])
BLAST of Medtr0002s0100.1 vs. NCBI nr
Match: gi|308054919|gb|ADO01506.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Panax ginseng])
BLAST of Medtr0002s0100.1 vs. NCBI nr
Match: gi|400946|sp|P30828.1|RBL_MAGLA (RecName: Full=Ribulose bisphosphate carboxylase large chain; Short=RuBisCO large subunit >gi|930008|emb|CAA38232.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Magnolia latahensis])
BLAST of Medtr0002s0100.1 vs. NCBI nr
Match: gi|168830685|gb|ACA34601.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Villarsia calthifolia])
BLAST of Medtr0002s0100.1 vs. NCBI nr
Match: gi|299474302|gb|ADJ18364.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Borszczowia aralocaspica] >gi|299474396|gb|ADJ18411.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Suaeda paradoxa])
BLAST of Medtr0002s0100.1 vs. NCBI nr
Match: gi|299474400|gb|ADJ18413.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Suaeda prostrata])
BLAST of Medtr0002s0100.1 vs. NCBI nr
Match: gi|299474402|gb|ADJ18414.1| (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Suaeda pterantha])
BLAST of Medtr0002s0100.1 vs. NCBI nr
Match: gi|371928277|gb|AEX58870.1| (ribulose 1,5-bisphosphate carboxylase [Viburnum opulus])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0100.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|407741987|gb|AFU34272.1|1.195510e-10196.64ribulose-1,5-bisphosphate carboxylase/oxygenas lar... [more]
gi|308054921|gb|ADO01507.1|1.341830e-10197.99ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|371928331|gb|AEX58897.1|1.936390e-10197.99ribulose 1,5-bisphosphate carboxylase [Viburnum ve... [more]
gi|308054919|gb|ADO01506.1|2.779320e-10197.99ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|400946|sp|P30828.1|RBL_MAGLA3.454880e-10195.97RecName: Full=Ribulose bisphosphate carboxylase la... [more]
gi|168830685|gb|ACA34601.1|4.321420e-10197.32ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|299474302|gb|ADJ18364.1|4.896860e-10197.32ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|299474400|gb|ADJ18413.1|5.004520e-10197.32ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|299474402|gb|ADJ18414.1|6.288330e-10197.32ribulose-1,5-bisphosphate carboxylase/oxygenase la... [more]
gi|371928277|gb|AEX58870.1|6.372700e-10197.32ribulose 1,5-bisphosphate carboxylase [Viburnum op... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000685Ribulose bisphosphate carboxylase, large subunit, C-terminalGENE3D3.20.20.110no descriptioncoord: 34..149
score: 3.7
IPR000685Ribulose bisphosphate carboxylase, large subunit, C-terminalSUPERFAMILY51649RuBisCo, C-terminal domaincoord: 35..149
score: 7.7
IPR017443Ribulose bisphosphate carboxylase, large subunit, ferrodoxin-like N-terminalGENE3D3.30.70.150no descriptioncoord: 1..33
score: 2.9
IPR017443Ribulose bisphosphate carboxylase, large subunit, ferrodoxin-like N-terminalSUPERFAMILY54966RuBisCO, large subunit, small (N-terminal) domaincoord: 1..34
score: 9.2
IPR020878Ribulose bisphosphate carboxylase, large chain, active sitePROSITEPS00157RUBISCO_LARGEcoord: 81..89
score
NoneNo IPR availableSEGsegsegcoord: 198..208
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0100.1 ID=Medtr0002s0100.1|Name=Medtr0002s0100.1|organism=Medicago truncatula|type=mRNA|length=696bp
ATGTTTACCTCCATTGTAGGTAATGTATTTGGGTTCAAGGCCTTGCGTGC
TCTACGTCTGGAAGATTTGCGAATCCCCGTTGCTTATGTTAAAACTTTCC
AAGGTCCTCCTCACGGAATCCAAGTTGAGAGAGATAAATTGAACAAATAT
GGATGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGTTTATCCGC
TAAAAATTACGGTAGAGCAGTTTATGAATGTCTACGTGGTGGACTTGATT
TTACCAAAGTTGATGAAAATGTGAACTCCCAACCATTTATGCGTTGGAGA
GACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCACAGGCCGAAAC
TGGTGAAATCAAAGGACATTATTTGAATGCTACTGCGGGCACCTGTGAAG
ACATGATGAAAAGAGCTGTATTTGCTAGAGAATTGGGCGTGCCTATCTGG
CAAGGAGCTCCTTCCAAGGACGTACGTATCTGGGGAATATCGGGTTCGAT
TCCCAAAAGGAACAACGCTTGGCCAGTGCACATGCCTCTAACAGAGGGCA
TTTTGTTGGAAACCGGTGCAAAAGAAAAAAAATATATATATGTTGTGGCC
TTCGTAGTATTTGAGGTAGTGGTGTCAGAACAGTCAATGGCAAACAGTAG
GAAACATCTATCCTCAGGCAAATATATGCTTCAGTCTGACCCCTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000685Ribulose bisphosphate carboxylase, large subunit, C-terminal
IPR017443Ribulose bisphosphate carboxylase, large subunit, ferrodoxin-like N-terminal
IPR020878Ribulose bisphosphate carboxylase, large chain, active site
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0000287magnesium ion binding
GO:0016984ribulose-bisphosphate carboxylase activity
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0009536plastid
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0015977carbon fixation