Overview
NameMedtr0002s0090.1
Unique NameMedtr0002s0090.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length3735
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0006952 defense response
biological_process GO:0050896 response to stimulus
biological_process GO:0006950 response to stress
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00560.28134715-134647625-6471-2216.71.6e-0627.41.4e-06
PF00931.17136071-135214173-4581-286258.51.7e-80259.62.1e-77
PF05729.7135999-135571197-3392-15920.59.3e-0821.60.00012
PF12799.2134715-134596625-6642-4031.14.2e-1153.21.4e-14
PF13855.1134715-134557625-6772-5529.31.7e-1058.73.1e-16

Homology
BLAST of Medtr0002s0090.1 vs. NCBI nr
Match: gi|502175746|ref|XP_004515733.1| (PREDICTED: putative disease resistance protein At3g14460-like isoform X1 [Cicer arietinum] >gi|502175750|ref|XP_004515734.1| PREDICTED: putative disease resistance protein At3g14460-like isoform X2 [Cicer arietinum] >gi|502175755|ref|XP_004515735.1| PREDICTED: putative disease resistance protein At3g14460-like isoform X3 [Cicer arietinum])
BLAST of Medtr0002s0090.1 vs. NCBI nr
Match: gi|502127140|ref|XP_004499578.1| (PREDICTED: putative disease resistance protein At3g14460-like [Cicer arietinum] >gi|532127448|gb|AGT75404.1| CC-NBS-LRR disease resistance protein [Cicer arietinum])
BLAST of Medtr0002s0090.1 vs. NCBI nr
Match: gi|502179928|ref|XP_004516528.1| (PREDICTED: putative disease resistance protein At3g14460-like [Cicer arietinum])
BLAST of Medtr0002s0090.1 vs. NCBI nr
Match: gi|502127636|ref|XP_004499781.1| (PREDICTED: putative disease resistance protein At3g14460-like [Cicer arietinum])
BLAST of Medtr0002s0090.1 vs. NCBI nr
Match: gi|502163726|ref|XP_004512929.1| (PREDICTED: putative disease resistance protein At3g14460-like isoform X1 [Cicer arietinum] >gi|564113523|gb|AHB64356.1| NBS-LRR protein [Cicer arietinum])
BLAST of Medtr0002s0090.1 vs. NCBI nr
Match: gi|356550917|ref|XP_003543829.1| (PREDICTED: putative disease resistance protein At3g14460-like [Glycine max])
BLAST of Medtr0002s0090.1 vs. NCBI nr
Match: gi|356577373|ref|XP_003556801.1| (PREDICTED: putative disease resistance RPP13-like protein 1-like [Glycine max])
BLAST of Medtr0002s0090.1 vs. NCBI nr
Match: gi|356577375|ref|XP_003556802.1| (PREDICTED: putative disease resistance RPP13-like protein 1-like isoform X1 [Glycine max] >gi|571564363|ref|XP_006605611.1| PREDICTED: putative disease resistance RPP13-like protein 1-like isoform X2 [Glycine max])
BLAST of Medtr0002s0090.1 vs. NCBI nr
Match: gi|356577440|ref|XP_003556833.1| (PREDICTED: putative disease resistance protein At3g14460-like isoform X1 [Glycine max] >gi|571564649|ref|XP_006605649.1| PREDICTED: putative disease resistance protein At3g14460-like isoform X2 [Glycine max])
BLAST of Medtr0002s0090.1 vs. NCBI nr
Match: gi|596017798|ref|XP_007218891.1| (hypothetical protein PRUPE_ppa000343mg [Prunus persica] >gi|462415353|gb|EMJ20090.1| hypothetical protein PRUPE_ppa000343mg [Prunus persica])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0090.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502175746|ref|XP_004515733.1|0.000000e+076.38PREDICTED: putative disease resistance protein At3... [more]
gi|502127140|ref|XP_004499578.1|0.000000e+073.89PREDICTED: putative disease resistance protein At3... [more]
gi|502179928|ref|XP_004516528.1|0.000000e+073.81PREDICTED: putative disease resistance protein At3... [more]
gi|502127636|ref|XP_004499781.1|0.000000e+074.32PREDICTED: putative disease resistance protein At3... [more]
gi|502163726|ref|XP_004512929.1|0.000000e+064.44PREDICTED: putative disease resistance protein At3... [more]
gi|356550917|ref|XP_003543829.1|0.000000e+052.26PREDICTED: putative disease resistance protein At3... [more]
gi|356577373|ref|XP_003556801.1|0.000000e+050.27PREDICTED: putative disease resistance RPP13-like ... [more]
gi|356577375|ref|XP_003556802.1|0.000000e+050.35PREDICTED: putative disease resistance RPP13-like ... [more]
gi|356577440|ref|XP_003556833.1|0.000000e+049.96PREDICTED: putative disease resistance protein At3... [more]
gi|596017798|ref|XP_007218891.1|0.000000e+045.03hypothetical protein PRUPE_ppa000343mg [Prunus per... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000767Disease resistance proteinPRINTSPR00364DISEASERSISTcoord: 197..212
score: 4.7e-20coord: 270..284
score: 4.7e-20coord: 369..383
score: 4.7e-20coord: 621..637
score: 4.7
IPR003591Leucine-rich repeat, typical subtypeSMARTSM00369no descriptioncoord: 600..623
score: 3.1coord: 647..670
score
NoneNo IPR availableCOILcoilcoiled-coilcoord: 41..62
score
NoneNo IPR availableGENE3D3.40.50.300no descriptioncoord: 171..313
score: 4.8
NoneNo IPR availableGENE3D3.80.10.10no descriptioncoord: 866..921
score: 5.6e-29coord: 959..1218
score: 1.4
NoneNo IPR availableSEGsegsegcoord: 38..51
score: NAcoord: 900..908
score: NAcoord: 928..939
score
NoneNo IPR availableSUPERFAMILY52058L domain-likecoord: 492..919
score: 1.2e-44coord: 939..1235
score: 5.7
NoneNo IPR availableSUPERFAMILY52540P-loop containing nucleoside triphosphate hydrolasescoord: 158..406
score: 1.5

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0090.1 ID=Medtr0002s0090.1|Name=Medtr0002s0090.1|organism=Medicago truncatula|type=mRNA|length=3735bp
ATGGCTGCAACTTTGGTGGGAGGGGCTTTTCTCTCTGCTACTGTTCAGAC
TTTAGTTGAGAAACTTGCTTCACAAGAGTTTTGTGATTACATCAGAAACA
CCAAGCTGAATTCCTCACTGTTGGCAGAGTTGGAAACAACACTGCTCGCT
CTTCAGGCGGTTCTTGATGATGCAGAACAGAAGCAAATCACCAACACTGC
TGTCAAACAATGGATGGATCAACTGAAAGATGCAATCTATGATGCTGAGG
ATTTGCTTAACCAAATCAATTACGACTCCCTCCGATGTAAGGTGGAGAAG
ATACAATCTGAAAACATGACTAATCAGGTTTGGAACCTCTTTTCATGTCC
TTTTAAAAATCTCTATGGAGAGATCAATTCACAAATGAAGATTATGTGTC
AAAGGCTGCAACTTTTTGCACAACAGAGAGATATCCTTGGCTTGCAAACT
GTGAGCGGGAGAGTTTCTCTAAGAACGCCTTCAAGTTCAATGGTAAATGA
ATCTGTTATGGTTGGAAGGAAGGATGATAAAGAGAGACTCATTAGTATGT
TGATATCTGACAGTGGCACTACCAATAGTAGTATTGGTGTGGTTGCAATT
TTGGGTATGGGCGGTGTTGGCAAAACCACTCTTGCCCAACTTCTTTATAA
TGATAAAGAAGTTCAAGACCATTTTGATCTGAAAGTCTGGGTTTGTGTAT
CGGAGGATTTCGATATTCTGAGAGTAACTAAAACCATTCATGAATCTGTC
ACTTCAAGAGGTGGTGAAAACAATAATCTTGATTTTCTTCGAGTTGAATT
GAATCAAAACTTGAGGGATAAAAGATTTTTGTTAGTGCTGGACGATCTGT
GGAATGATAGTTATAATGATTGGGATGAGTTAGTAACTCCATTGATTAAC
GGCAAAACGGGAAGTATGGTGATCATCACAACACGCCAACAAAAAGTTGC
GGAGGTTGCACACACGTTTCCTATTCACAAAGTAGATCCTCTATCAGATG
ATGACTGTTGGTCGTTACTTTCAAAGCATGCATTCGGAAGTGAAGACCGT
CGAGGTAGAAAGTACCCAAATCTAGAAGAAATTGGTAGAAAGATTGCCAA
AAAGTGTGGTGGATTGCCCATAGCTCCTAAAACACTCGGAGGAATTTTGC
GTTCAAAGGTAGATGCAAAAGAGTGGACTGCAATTCTAAATAGTGACATA
TGGAACTTACCAAATGATAATATTTTACCTGCTTTGCGTCTAAGTTATCA
ATATCTTCCCTCACATTTGAAAAGATGTTTTGCCTATTGCTCAATTTTTC
CGAAGGATTTTCCACTGGACAAGAAGGAATTGATTTTGTTATGGATGGCA
GAAGGCTTCCTAGAGCATTCTCAACGTAATAAAACAGCTGAGGAAGTAGG
CCATGACTACTTTATTGAATTGTTATCCAGGTGCTTAATTCAACAATCAA
ATGATGATGGAAAAGAAAAATTTGTTATGCATGACCTTGTCAATGATTTA
GCCTTAGTGGTGTCAGGAACAAGTTGCTTCAGGCTTGAATGTGGTGGTAA
CATGTCTAAAAATGTACGTCATTTGTCATATAATCAAGGATATTACGACT
TTTTCAAGAAGTTTGAGGTTCTCTACGATTTCAAATGGTTGCGGAGCTTT
CTACCCGTTAACCTTAGTATCGTGAAGGGATCATATTGCTTATCTAGTAA
GGTTGTTGAAGATTTAATACCCAAACTCAAACGGTTACGTGTGCTATCCT
TAAAAAATTATCAAAACATCAACCTGCTGCCAGAATCAGTAGGTAGTTTG
GTGGAGTTGAGGTATTTAGATCTCTCATTCACTGGAATTAAAAGCTTACC
TAATGCAACATGCAATCTTTACAATCTGCAAACCTTGAATTTAACACGGT
GTGAAAACCTCACTGAGTTGCCACCAAATTTTGGAAAGTTAATTAACTTA
CGGCACCTTGATATCAGCGGGACATGCATAAAGGAGATGCCAACGCAAAT
TCTTGGACTCAATAACCTGCAAACATTAACTGTTTTTTCAGTTGGCAAGC
AAGACACCGGGTTAAGTTTGAAAGAGGTTGGTAAGTTTCCTAACCTACGG
GGAAAGCTTTGTATCAAGAACCTGCAGAATGTCATCGATGCCATTGAGGC
TTATGATGTCAACATGAGAAACAAAGATATTGAGGAATTAGAGTTACAAT
GGAGCAAACAAACGGAAGACTCGCGAATAGAGAAAGATGTGCTTGATATG
TTGCAACCATCATTTAACCTGAGGAAACTGAGCATTAGCTTGTATGGTGG
GACAAGCTTTCCGAGTTGGTTGGGTGATCCTTTTTTTTCTAACATGGTGT
CCTTGTGTATCTCGAATTGTGAATATTGTGTAACACTTCCATCACTAGGT
CAACTACCTTCTCTCAAGGACTTGACTATTGAGGGTATGACAATGGAAAC
AATTGGGCTAGAGTTCTATGGCATGACAGTAGAACCTTCCACTTCTTCAT
TCAAACCATTTCAGTATCTCGAGTCTTTAAAATTCTTTAGCATGCCGAAT
TGGAAGGAATGGATACACTATGAAAGTGGTGAATTTGGTTTTCCTCGCCT
TAGAACTTTGCGCTTAAGCCAATGTCCTAAACTAAGGGGGAATTTGCCTA
GCAGTCTTCCTTCAATAGATAAAATCAATATAACTGGTTGTGACCGTCTC
TTGACAACACCACCAACTACTTTGCATTGGCTCTCCTCATTAAACAAAAT
AGGTATAAAAGAGTCTACAGGAAGTTCCCAATTGTTGTTACTTGAAATTG
AATCTCCCTGTTTGCTACAAAGTGTAAAAATCATGTATTGTGCTACCCTG
TTTTCGTTACCCAAAATTATTTGGAGCAGCATTTGTCTTCGATTCTTGGA
ACTTTGTGATCTTCCATCTCTCGCTGCTTTTCCAACAGATGATCTACCCA
CTTCATTGCAGTCACTTAGAATTTCTCATTGTCCGAATTTAGCATTCCTG
CCACTTGAAACATGGGGCAATTACACATCTCTTGTGGCTTTGCACTTATT
GAATAGTTGTTATGCACTTACCTCATTCCCTTTGGATGGTTTCCCAGCCC
TCCAAGGTCTTTACATTGATGGCTGTAAAAATCTGGAATCCATTTTTATT
TCAGAAAGTTCTTCCCATCTCCCGTCAACCCTCCAATCATTTAGGGTAGA
TAATTGTGATGCACTTAGATCATTGACTCTACCAATAGACACCCTGATCT
CTCTTGAACGTTTGTCTCTCGAAAATCTTCCAGAACTAACTTTACCATTT
TGTAAAGGAACTTGCCTACCTCCCAAAATACGAAGTATTTATATTGAATC
AGTGAGAATAGCAACGCCTGTAGCTGAATGGGGTCTCCAACATCTTACTT
CTCTTTCAAGTTTGTATATGGGAGGTTACGATGATATTGTTAACACCTTG
CTGAAGGAGCGGTTGCTGCCAATTTCACTTGTGTCTTTGTATATTTCTAA
TCTCTGTGAAATAAAATCCATTGATGGAAATGGACTCCGACACCTATCCT
CTCTTGAAACACTTTGTTTTTATAATTGTCCAAGGCTTGAGTCTCTTTCA
AAAGACACTTTTCCATCCTCTCTTAAGATACTGCGCATCATTGAATGTCC
TCTGTTAGAAGCAAACTATAAAAGTCAGAGGTGGGAACATTTGTCCATCC
CAGTCTTGGAAATAAATAACGAAGTGATAATATGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000767Disease resistance protein
IPR003591Leucine-rich repeat, typical subtype
noIPRunintegrated
Vocabulary: Biological Process
TermDefinition
GO:0006952defense response
GO:0006950response to stress
GO:0008150biological_process
GO:0050896response to stimulus
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005634nucleus
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part