Overview
NameMedtr0001s0490.1
Unique NameMedtr0001s0490.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1014
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0048366 leaf development
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0048827 phyllome development
biological_process GO:0048367 shoot system development
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
biological_process GO:0048731 system development
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
molecular_function GO:0005524 ATP binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF08879.5398359-39849389-1331-4578.42.9e-2679.21.1e-22
PF08880.6398164-39826824-581-3558.34.5e-2059.41.4e-16

Homology
BLAST of Medtr0001s0490.1 vs. NCBI nr
Match: gi|356538349|ref|XP_003537666.1| (PREDICTED: growth-regulating factor 4-like [Glycine max])
BLAST of Medtr0001s0490.1 vs. NCBI nr
Match: gi|449468402|ref|XP_004151910.1| (PREDICTED: growth-regulating factor 3-like [Cucumis sativus] >gi|449484096|ref|XP_004156783.1| PREDICTED: growth-regulating factor 3-like [Cucumis sativus])
BLAST of Medtr0001s0490.1 vs. NCBI nr
Match: gi|255558115|ref|XP_002520086.1| (conserved hypothetical protein [Ricinus communis] >gi|223540850|gb|EEF42410.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0001s0490.1 vs. NCBI nr
Match: gi|460401372|ref|XP_004246199.1| (PREDICTED: growth-regulating factor 3-like [Solanum lycopersicum])
BLAST of Medtr0001s0490.1 vs. NCBI nr
Match: gi|460415480|ref|XP_004253086.1| (PREDICTED: growth-regulating factor 5-like [Solanum lycopersicum])
BLAST of Medtr0001s0490.1 vs. NCBI nr
Match: gi|255645400|gb|ACU23196.1| (unknown [Glycine max])
BLAST of Medtr0001s0490.1 vs. NCBI nr
Match: gi|115466038|ref|NP_001056618.1| (Os06g0116200 [Oryza sativa Japonica Group] >gi|75120357|sp|Q6AWY4.1|GRF5_ORYSJ RecName: Full=Growth-regulating factor 5; Short=OsGRF5; AltName: Full=Transcription activator GRF5 [Oryza sativa Japonica Group] >gi|51039839|tpg|DAA05209.1| TPA_exp: growth-regulating factor 5 [Oryza sativa (japonica cultivar-group)] >gi|55296197|dbj|BAD67915.1| putative growth-regulating factor 1 [Oryza sativa Japonica Group] >gi|113594658|dbj|BAF18532.1| Os06g0116200 [Oryza sativa Japonica Group] >gi|215737190|dbj|BAG96119.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218197454|gb|EEC79881.1| hypothetical protein OsI_21387 [Oryza sativa Indica Group])
BLAST of Medtr0001s0490.1 vs. NCBI nr
Match: gi|357110736|ref|XP_003557172.1| (PREDICTED: uncharacterized protein LOC100842886 [Brachypodium distachyon])
BLAST of Medtr0001s0490.1 vs. NCBI nr
Match: gi|116310919|emb|CAH67857.1| (B0403H10-OSIGBa0105A11.9 [Oryza sativa Indica Group])
BLAST of Medtr0001s0490.1 vs. NCBI nr
Match: gi|408407697|sp|Q6AWY6.2|GRF3_ORYSJ (RecName: Full=Growth-regulating factor 3; Short=OsGRF3; AltName: Full=Transcription activator GRF3 [Oryza sativa Japonica Group] >gi|38345778|emb|CAD41819.2| OSJNBa0083N12.16 [Oryza sativa Japonica Group] >gi|218195498|gb|EEC77925.1| hypothetical protein OsI_17259 [Oryza sativa Indica Group] >gi|222629484|gb|EEE61616.1| hypothetical protein OsJ_16036 [Oryza sativa Japonica Group])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0490.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356538349|ref|XP_003537666.1|4.011760e-14874.20PREDICTED: growth-regulating factor 4-like [Glycin... [more]
gi|449468402|ref|XP_004151910.1|3.542080e-14565.01PREDICTED: growth-regulating factor 3-like [Cucumi... [more]
gi|255558115|ref|XP_002520086.1|1.555440e-13272.31conserved hypothetical protein [Ricinus communis] ... [more]
gi|460401372|ref|XP_004246199.1|3.797880e-10349.85PREDICTED: growth-regulating factor 3-like [Solanu... [more]
gi|460415480|ref|XP_004253086.1|1.342290e-9849.85PREDICTED: growth-regulating factor 5-like [Solanu... [more]
gi|255645400|gb|ACU23196.1|9.585260e-8568.04unknown [Glycine max][more]
gi|115466038|ref|NP_001056618.1|3.940760e-8143.97Os06g0116200 [Oryza sativa Japonica Group] >gi|751... [more]
gi|357110736|ref|XP_003557172.1|1.239810e-7842.09PREDICTED: uncharacterized protein LOC100842886 [B... [more]
gi|116310919|emb|CAH67857.1|5.010600e-7842.66B0403H10-OSIGBa0105A11.9 [Oryza sativa Indica Grou... [more]
gi|408407697|sp|Q6AWY6.2|GRF3_ORYSJ2.102550e-7742.74RecName: Full=Growth-regulating factor 3; Short=Os... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR014978Glutamine-Leucine-Glutamine, QLQSMARTSM00951no descriptioncoord: 24..60
score: 4.3
NoneNo IPR availableSEGsegsegcoord: 1..24
score: NAcoord: 59..73
score: NAcoord: 238..254
score: NAcoord: 316..333
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0490.1 ID=Medtr0001s0490.1|Name=Medtr0001s0490.1|organism=Medicago truncatula|type=mRNA|length=1014bp
ATGAATAGCTCTGGGGGTGGCAGTAGTAACGGAGGAGGTGTAGGGATGAT
GATGGGTTACAGTAAATCATCACCATTCACAGTGTCTCAGTGGCAGGAAC
TTGAACATCAAGCTTTGATCTTTAAATATATGGTTGCTGGTCTTCCTGTT
CCACCTGATCTTGTCCATCCTATTCATTCCAGCTTTCACTCTCTTTCTTC
TAATAATTTCTTTCACCACCCTATTCCTACCTTGAGTTACTGTTCCTTCT
ATGGGAAGAAGGTGGACCCGGAGCCAGGAAGATGTAGGAGGACTGATGGA
AAAAAGTGGAGGTGCTCGAAGGAAGCATACCCAGACTCCAAGTACTGTGA
GCGCCACATGCACCGTGGCCGCAACCGTTCAAGAAAGCCTGTGGAATCAC
AAACTATGGCACAGTCGACATCCACTGTGACATCGCTGACTGTCGCTGGT
GGCAGCAGCAGAGCTGGTAACTTCCAGAACATTCCCACAACAAATGCATT
TGGTAGTGTTCAAAATACTACAGGTTCTGGAACCGACCGTGCCGATTATC
ATCTTGATACCATTCCCTATGGGATTCCAAGTAAAGAATACAGGTATCTT
CAAGGTCTTAAATCTGAGGGTGGAGAACATAGCTTCTTTGCAGAAGCTTC
AAGAGGAGACAACAAGGGTCTCCAAATGGAGTCGCAGCTGGAAAACACAT
GGCCTTTGATGTCAACTAGAGTTGCCTCTTTTTCTGCATCAAAATCAAGC
TGTAATAATTCCATGTTGCAGAGTGATTATCCCCAACATTCATTTTTATC
TAGTGAATATGGATCTGGAGAAGCTGTGAAGGAAGAGGGCCAGCCTCTTC
GACCCTTTTTCAGAGAATGGCCTAAGAGCAGAGAGTCATGGTCTGGTTTG
GAAGATGAGAGATCCAACCAAACAGCATTCTCCACAACTCAACTTTCAAT
ATCCATTCCTATGTCATCGTCTGAATTCTCTGCCACAAGCTCTCAGTCAC
CACACGATAACTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR014978Glutamine-Leucine-Glutamine, QLQ
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005524ATP binding
Vocabulary: Cellular Component
TermDefinition
GO:0005634nucleus
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0007275multicellular organismal development
GO:0008150biological_process
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048366leaf development
GO:0048367shoot system development
GO:0048731system development
GO:0048827phyllome development
GO:0048856anatomical structure development