Overview
NameMedtr0001s0190.1
Unique NameMedtr0001s0190.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length309
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF09713.564258-6441614-661-5396.25.6e-3297.43.4e-28

Homology
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|225448833|ref|XP_002282451.1| (PREDICTED: uncharacterized protein LOC100244913 [Vitis vinifera] >gi|296086934|emb|CBI33167.3| unnamed protein product [Vitis vinifera])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|255585984|ref|XP_002533662.1| (conserved hypothetical protein [Ricinus communis] >gi|223526444|gb|EEF28721.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|470143602|ref|XP_004307462.1| (PREDICTED: uncharacterized protein LOC101296040 [Fragaria vesca subsp. vesca])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|565468496|ref|XP_006292115.1| (hypothetical protein CARUB_v10018311mg [Capsella rubella] >gi|482560822|gb|EOA25013.1| hypothetical protein CARUB_v10018311mg [Capsella rubella])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|590564053|ref|XP_007009551.1| (Plant protein 1589 of Uncharacterized protein function [Theobroma cacao] >gi|508726464|gb|EOY18361.1| Plant protein 1589 of Uncharacterized protein function [Theobroma cacao])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|356502444|ref|XP_003520029.1| (PREDICTED: uncharacterized protein LOC100795820 isoform X1 [Glycine max])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|449459944|ref|XP_004147706.1| (PREDICTED: uncharacterized protein LOC101203417 [Cucumis sativus] >gi|449513505|ref|XP_004164343.1| PREDICTED: uncharacterized LOC101203417 [Cucumis sativus])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|115464331|ref|NP_001055765.1| (Os05g0462000 [Oryza sativa Japonica Group] >gi|47900330|gb|AAT39177.1| unknown protein [Oryza sativa Japonica Group] >gi|47900354|gb|AAT39184.1| unknown protein [Oryza sativa Japonica Group] >gi|113579316|dbj|BAF17679.1| Os05g0462000 [Oryza sativa Japonica Group] >gi|222631863|gb|EEE63995.1| hypothetical protein OsJ_18824 [Oryza sativa Japonica Group])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|596027712|ref|XP_007219284.1| (hypothetical protein PRUPE_ppa018490mg [Prunus persica] >gi|462415746|gb|EMJ20483.1| hypothetical protein PRUPE_ppa018490mg [Prunus persica])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|125552623|gb|EAY98332.1| (hypothetical protein OsI_20242 [Oryza sativa Indica Group])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0190.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|225448833|ref|XP_002282451.1|1.268340e-3669.15PREDICTED: uncharacterized protein LOC100244913 [V... [more]
gi|255585984|ref|XP_002533662.1|2.063620e-3671.91conserved hypothetical protein [Ricinus communis] ... [more]
gi|470143602|ref|XP_004307462.1|2.318040e-3675.58PREDICTED: uncharacterized protein LOC101296040 [F... [more]
gi|565468496|ref|XP_006292115.1|3.124220e-3669.79hypothetical protein CARUB_v10018311mg [Capsella r... [more]
gi|590564053|ref|XP_007009551.1|5.946810e-3672.83Plant protein 1589 of Uncharacterized protein func... [more]
gi|356502444|ref|XP_003520029.1|7.032250e-3575.49PREDICTED: uncharacterized protein LOC100795820 is... [more]
gi|449459944|ref|XP_004147706.1|8.539220e-3465.52PREDICTED: uncharacterized protein LOC101203417 [C... [more]
gi|115464331|ref|NP_001055765.1|3.382680e-3362.63Os05g0462000 [Oryza sativa Japonica Group] >gi|479... [more]
gi|596027712|ref|XP_007219284.1|5.117080e-3366.30hypothetical protein PRUPE_ppa018490mg [Prunus per... [more]
gi|125552623|gb|EAY98332.1|5.997960e-3361.62hypothetical protein OsI_20242 [Oryza sativa Indic... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR006476Conserved hypothetical protein CHP01589, plantTIGRFAMsTIGR01589A_thal_3526: uncharacterized plant-specifcoord: 11..67
score: 5.8

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0190.1 ID=Medtr0001s0190.1|Name=Medtr0001s0190.1|organism=Medicago truncatula|type=mRNA|length=309bp
ATGGGGGACTCATCTTCTTCGGCTTCATACATTCACTTGGTGCAGCACCT
GATCGAAAAGTGTTTGATCTTTCACATGACAAAGGAAGAGTGCATGGAAG
CGCTCTCTAAACATGCAAATATAAATCCAACTATAACATCCACTGTGTGG
AATGAGCTAGAGAAGGTGAACAAGGAATTTTTTGAGGCATATAAGATGAA
GCCAAAGAATAATGAAGAGATAATGATGTCCCAGGAAGAGACAACTCGGA
TGTTACAGAAGATGATCTCAGCTTCGGATTCCTCTAAAGGTGCACAACAC
GACGATTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR006476Conserved hypothetical protein CHP01589, plant